Apparently there are people who read this blog. Here's an article from the Milwaukee-Wisconsin Journal Sentinel dated February 1, 2010:
The Cell Peddlers: Dealing Hope to Desperate Families
Sorting out the sales pitch
The Internet has helped companies spread the word of 'miracle' recoveries, but families have to tread carefully
By Meg Kissinger of the Journal Sentinel
Posted: Feb. 1, 2010
Second of two parts
Megg Lasswell was writing a blog entry about her baby daughter's vision problems when an intriguing message popped on the screen.
Her daughter, GiGi, was born with optic nerve hypoplasia, making her able to see only blurry outlines and shapes. The message read:
"I can treat your child's ONH. You can look me up on the web if you like. My name is Kirshner Ross-Vaden and I work for a bio-tech company. Check out www.stemcellschina.com and www.beikebiotech.com. It is real. My email is kirshner@beikebiotech.com. I hope to hear from you. K"
Curious, Lasswell e-mailed Ross-Vaden for more details, but any hopes she had that the treatments would work faded. Over the course of the next several weeks, she learned that it would cost $30,000 or more for an unproven stem cell procedure with no reasonable hope of a cure.
Lasswell was livid.
"It's obvious now that these people don't care about our families," she said in her blog. "They are using a support group to offer people the world, or at least vision for their children. How cheap and disgusting is that?"
The company behind the unsolicited e-mail was Beike Biotechnology, a China-based enterprise that claims to be able to treat cerebral palsy, autism, spinal cord injuries, optic nerve disorders and two dozen other conditions with stem cells. Scientists say the treatments rely on flawed theories, have not been vetted to tell if they will make any difference and amount to patients paying to be subjects of an experiment.
Just as scientists are critical of Beike's medical claims, marketing experts say the company uses questionable tactics, relying on patient testimonials that are difficult - if not impossible - to verify. It tries to lure customers by using emotional accounts from those who have the most at stake: Patients and their families who have often solicited the financial support of a community hungry for happy endings.
With its aggressive approach, Beike (pronounced Bay-Ka) has built itself into one of the largest stem cell companies in the world. It has done so by using the Internet to spread one unchecked "miracle" story after another, like a modern-day game of telephone. With each retelling, the stories and their alleged results get a little more fantastic.
As part of its examination of Beike, the Journal Sentinel built a database of all the patients listed on the company's Web site. Reporters contacted more than two dozen of them to see how they learned of Beike and what their experiences with the company were. The newspaper found:
• Unsolicited contact: The company's marketing agents troll the Internet looking for families desperate for cures and offer them unrealistic medical outcomes. In one case, a representative quoted a 98% improvement rate for an unproven treatment, which scientists call outrageous.
Alex Moffett, chief executive officer of Beike's holding company, said that recruiters' tactics and claims are "impossible to control" and that Beike "obviously cannot police all such activities."
• Inaccurate information: The company perpetuates inaccurate or unsubstantiated information about the treatments on its Web site by linking to scores of newspaper and TV stories. These emotional accounts often lack any substantiation from doctors or scientists. The stories then entice others to seek Beike's treatments. The company does not list unfavorable stories that challenge the effectiveness of its treatments.
• Hidden ties: Beike's marketing agents, also called "facilitators" or "medical liaisons," funnel patients into a sophisticated system that provides help in raising money, making travel arrangements to China, securing passports, even wiring money to China to pay for the treatment. Some company agents have exaggerated their expertise and offered confusing descriptions of their relationships to the company.
Nevertheless, hundreds of families - including several from Wisconsin - have each spent tens of thousands of dollars on these treatments in recent years, often defying their doctors' advice and eliminating their chance to participate in rigorous clinical trials in the United States.
"Plenty of companies use the Internet to find customers," said Susan Lederer, chairman of the department of medical history and bioethics at the University of Wisconsin-Madison. "But it seems particularly sleazy to take advantage of those who are desperate. These are people who are under stress. They are especially vulnerable to this hucksterism."
Moffett defended his sales staff and said he had little control over how they seek clients.
"Our young international staff members are passionate about stem cell therapies," he wrote in an e-mail to the Journal Sentinel. "They are on the Internet many hours a day and have expressed personal comments and are involved in various levels of interaction with blogs and other forums for comment and discussion. Beike feels this is their right to communicate as they wish."
More than two years after Lasswell was contacted by Beike, her daughter's sight is improving on its own. But Lasswell remains angry at the solicitation from Ross-Vaden.
"It was gross the way that she fished the Internet looking for me," said Lasswell, of Oakland, Calif.
Although Ross-Vaden said in her overture to Lasswell that she could treat her daughter's condition, Ross-Vaden is not a doctor or research scientist. Ross-Vaden said she developed Beike's protocol for treating the disease, but company officials deny that.
She says she is a registered nurse, but will not say where she is licensed.
The Journal Sentinel interviewed Ross-Vaden last year at her home in suburban Chicago. She refused to provide key information, such as where she received her degree, and did not want the name of her community mentioned.
"I've been harassed and threatened too many times," she said.
Ross-Vaden said that when she solicited Lasswell in 2007, she was working for Beike as vice president of the company's foreign patient division and she regularly traveled to China to help set up and supervise the treatments.
But Moffett said Ross-Vaden was not an employee. Rather she was paid a commission for each patient she referred.
However, Ross-Vaden said she was paid a straight salary and declined Beike's offer of a commission for new patients.
"I didn't feel comfortable taking a percentage," she said.
Ross-Vaden said she quit the company in March 2009 because she wanted to try to have another baby. She continues to recommend Beike to people she meets on the online chat room she supervises from her house.
Ross-Vaden said she became interested in stem cell treatments when her son, Justin, was born with significant brain injuries and received stem cell treatments in Mexico. He died four years ago at the age of 2.
She said she found Lasswell by setting up a program on her computer that would alert her to any stories or blog entries about certain diseases. She was surprised to hear of Lasswell's criticism.
"I'm offering hope," Ross-Vaden said. "No one has to take it."
When a patient signs on to pay for treatments, Beike often assigns a facilitator, also known as a medical liaison.
The company sets up blogs for its patients and encourages them to write about their time in China so that others can see how the treatment is going.Once patients are home, Beike officials follow the blogs to ensure they provide a positive spin, according to some patients.
Richard Chin went to China in March 2007 for stem cell injections to treat ataxia, a disease of the nervous system.
Soon after he returned home, his wife wrote on their blog that Chin was scheduled to see his doctor for a post-treatment consultation. The blog also mentioned Chin had recently sprained his foot.
Three days before the scheduled doctor's appointment, the couple got an e-mail from Jon Hakim, then a Beike official, asking Chin to postpone the visit for another week.
Hakim referenced the foot injury and told them he wanted Chin to see the doctor on "an up day instead of a down day."
Chin's wife, Lilly Lock, was left feeling that Beike employees were monitoring what they wrote to affect the outcome of his medical examination.
"I cannot shake the feeling that Big Brother is watching," Lock wrote on the blog. "Is Jon using our blog to monitor us? I'd like to believe that he is interested in Richard's health as a friend and not as a salesperson of stem cell treatment. However, some of his requests can be construed as too self-serving."
Hakim also asked the couple to remove from their blog a link to a Wall Street Journal article that was critical of the company.
Hakim, who quit his job at Beike late last month, said he "asked nicely that they wait a little while" until Chin was feeling better.
"It's usually best to have the patient go in before and after evaluations in a similar state to get a real feel for the effects of the treatment."
Hakim said he left the company to take a job at a wireless start-up in China.
Beike markets itself aggressively on the Internet, such as with a flier that circulated before Christmas 2008:
"Join us in China to celebrate the holidays and we will wrap up 15 million little gifts to go under your tree for free! . . . Book to arrive in China and receive treatment in the month of December and you will receive a free stem cell transplant with approximately ten to fifteen million stem cells."
Smaller print explained: "certain restrictions do apply."
MEDIA ACCOUNTS
Many patients, though, find Beike through glowing stories in their local media.
Brandon Meinke of Janesville has Type 2 spinal muscular atrophy, a degenerative and potentially crippling disease. A relative sent his grandparents a story from Florida about a boy who had gone to Beike for stem cell treatments.
"We went on their Web site and saw all of these stories, and we felt like we had to try," said Sharon Vaughan, Brandon's grandmother.
In September 2008, a local TV station and the local newspaper ran stories on Brandon's upcoming trip. The newspaper story paraphrased a statement from Brandon's grandfather, Ron Martin: "There is no cure for Brandon's disorder, but other patients are proving the stem cell injections stop the progression."
Medical experts in spinal muscular atrophy say there is no such proof.
"I would argue there is absolutely no data to indicate cord blood will help with spinal muscular atrophy," said Stephen Minger, a British stem cell scientist who has studied the disease. "I can't imagine what it is that cord blood will do to help reverse that. . . . It is just ridiculous to believe that this is going to work."
When Kyle Knopes, a Janesville teenager with the same condition, read about Brandon, his hopes soared.
Kyle, now 17, was diagnosed as a baby with the condition. He had used a wheelchair since he was 18 months old. Conventional treatments weren't slowing the disease. By the time Kyle was 15, his neck muscles were too weak to support his head, and his fingers were starting to curl, making it difficult to hold a fork.
Kyle's doctor advised him and his family not to go, but by the following summer, in August 2009, Kyle and his mother and brother were off to China. They sent the company $27,500 and while they were in China, Kyle's father wired $3,500 for another injection. Kyle said he's greatly improved since he returned, having received eight injections of umbilical cord stem cells. He can hold his head up, grip a pen and even roll from side to side, something he said he hadn't been able to do in years.
But no doctor has measured Kyle's progress since he returned.
A handful of American doctors who have examined Beike patients before and after treatments for different conditions told the Journal Sentinel that they saw no change. In some cases, patients have reported fleeting improvements - and when they regress, Beike has used it as an opportunity to sell them another round of therapy.
Stem cell experts say the improvements patients report could be a placebo effect.
"Some patients report these kind of 'dramatic' improvements, but generally they don't last," said Minger, who is director of the stem cell biology lab at King's College in London.
Kyle said he doesn't care what other people think about whether these treatments work or not.
"I know what I could do before and what I can do now," he said. "It doesn't matter what people think or say about the treatments I got. How I feel is all that matters."
He now travels to schools around Janesville talking about the benefits of stem cell treatments, and stories about him are now among those promoted on Beike's Web site.
"I just had a woman from Canada call," Kyle said recently. "I think she's going to go."
Journalism ethics experts say reporters have to be careful not to play into the company's claims or they risk becoming unwitting barkers for an unproven product.
"Otherwise, we're back to the days of selling snake oil on the streets," said Stephen Ward, a professor of journalistic ethics at the University of Wisconsin-Madison.
"Studies show that the public makes medical decisions on what they see in the media," he said. "People who are sick want hope. They are ripe for being used. The chief journalistic rule is to be skeptical, check it out. A feel-good miracle story doesn't overcome a reporter's need to verify.
INTERNET SEARCH
Increasingly, people look to the Internet for health information, said Susannah Fox of the Pew Research Center in Washington, D.C. But many people aren't discriminating enough about the information they find there, she said.
The Internet is a source of power for people, particularly those who feel powerless against an incurable disease, Fox said.
"People facing medical crises want to become superheroes," she said. "They want to save a life. They believe the answer is out there if they can find it. "
Federal Trade Commission rules prohibit a company from making false claims on the Internet. But enforcement can be difficult when the company is based in another country, said Richard Cleland, an FTC spokesman.
He declined to say whether the FTC has had complaints about Beike.
Of all the cases that the Journal Sentinel reviewed, none got more public attention than that of Macie Morse.
The 16-year-old from northern Colorado went to China in the summer of 2008 for treatment of optic nerve hypoplasia.
She and her mother are claiming a miracle.
But the ophthalmologist who examined her before and after the treatments could find no improvement, said Macie's mother, Rochelle Morse. And experts in optic nerve hypoplasia said children with the condition often experience improved vision without any treatment at all.
Whatever the reason, Macie's eyesight has improved enough that she was granted a driver's permit last March.
However, the permit requires that she wear glasses specially fitted with a binocular-like device that allows her to see the lines on the road. In school, she requires a telescope to see the blackboard.
When Macie was featured on television news shows throughout Colorado after she got her driver's permit, she was not shown wearing the glasses and no mention was made of them.
"This is crazy!" Macie exclaims in one broadcast, as she drives the van down the street.
Shaun Boyd, a television reporter from Denver riding with her, says: "Crazy in a miracle-can-happen way."
Boyd, a reporter for CBS4 in Denver, said she didn't remember whether anyone told her Macie needed to wear the special glasses to drive.
"This is TV," Boyd said. "We drove around the block. It's not like I asked her not to wear the glasses so that we'd have a better shot or anything like that."
Rochelle Morse told the Journal Sentinel they weren't trying to fool viewers. She said Macie did not wear her glasses because it was only a short drive.
Beike officials said it should not be an issue.
"Regardless of why she was photographed like this, what a miracle for this child!" said Moffett. "It seems silly to try and find fault with such a wonderful outcome and the obviously life transformative benefits for her and the family."
Rochelle Morse organized an online chat room where she urges all who are considering it to go to China for the treatments. She also organizes medical awareness rallies to tout the benefits of the treatments.
At one such rally last year in Florida, Macie was the most anticipated speaker. She told the crowd that vision in one of her eyes has gone from 20/400 to 20/80.
"I saw snow fall for the first time," she told the crowd.
When asked to document Macie's improvement, Beike officials offered months ago to provide the Journal Sentinel with her medical records. They have not done so despite repeated requests.
Beike has compensated Macie's family for such testimonials with free transportation around China - a fact not mentioned at the rally.
Having spent $30,000 the first time, the family is getting ready to go back sometime this month for more treatment, hoping for still more improvement.
Rochelle Morse said in an interview she will ask the company for a discount for their upcoming trip for more treatments because of all the publicity the family has generated for the company.
At the rally, she had a message for the skeptics.
"It's not the placebo effect," she said, "and if it is, screw them. It works."
HOW UNVERIFIED CLAIMS ARE SPREAD
• Ron Martin, whose grandson, Brandon, suffers from Type 2 spinal muscular atrophy, gets a story from a Florida newspaper about a patient with the same disease who went to China for Beike's stem cell treatments. They, too, plan a trip to China.
• In September 2008, the local newspaper runs a story on Brandon's trip to China for the treatments, quoting Martin that stem cells are proving to stop the disease. Local TV stations also do stories.
• Kyle Knopes, who has the same disease, reads the story and calls Martin for more information. He plans a trip, too.
• The company, trading on the credibility of the media outlets, posts the stories on its Web site.
RALLYING CRY
In March 2009, a Journal Sentinel reporter attended a stem cell awareness rally in Punta Gorda, Fla., organized by a supporter of Beike Biotechnology.
The event, held in a gazebo overlooking Charlotte Harbor, brought together both prospective and former patients, including children who had received treatment from Beike for optic nerve hypoplasia. About 75 people attended.
Those in the crowd included Beike officials and others, purporting to be independent, whose actual roles and relationships to the company were not made clear. One example:
One of the speakers was Ali A. Hakim, introduced as an expert in stem cells.
Hakim, 82, a urologist who lives in Minnesota, is the father of Jon Hakim, then Beike's marketing director.
Ali Hakim gave a talk praising the company's work, but was vague when asked about his relationship to the company: "I have been working with them for four years. I don't work for them. I don't take one penny."
However, the event's organizer, Carol Petersen, whose grandson was treated by Beike, described herself as a salaried employee of Ali Hakim.
"He's part of them," she said of Hakim, "but I wouldn't call him a Beike employee."
Mark Johnson, the reporter from the Journal-Sentinel, who contacted us in January of this year for this article wrote the first part of this series here.
Friday, May 28, 2010
Saturday, April 17, 2010
CBS 60 Minutes April 18, 2010
Watch this program Sunday (April 18, 2010) evening at 7PM. (EST) The producer of this segment, Sam Hornblower, interviewed Richard by phone while he was gathering information on the subject of stem cell treatments. No, Richard does not have any "air time" on the program.
Click here for more information on this program.
Monday, January 18, 2010
THE NATIONAL ATAXIA FOUNDATION 53RD ANNUAL MEMBERSHIP MEETING
Happy New Year! I'm happy to report that Richard is doing well and adhering to his PT and exercise regime. His appetite is good and his choking spells infrequent.
We recently received an email about the National Ataxia Foundation (NAF) Annual Membership Meeting 2010 and would like to share it with you. The meeting will be held in Chicago from March 12th to 14th, 2010. We have attended the annual meetings for the last two years and have enjoyed them tremendously.
Here's the link with more information:
http://www.ataxia.org/events/annual-meeting2010.aspx
We recently received an email about the National Ataxia Foundation (NAF) Annual Membership Meeting 2010 and would like to share it with you. The meeting will be held in Chicago from March 12th to 14th, 2010. We have attended the annual meetings for the last two years and have enjoyed them tremendously.
Here's the link with more information:
http://www.ataxia.org/events/annual-meeting2010.aspx
Saturday, October 10, 2009
Stem Cell Tourism Revisited
We received an email from Jane Qiu today about her recently published article in the September 2009 issue of Nature Biotechnology. Jane had interviewed Richard in 2007 about his stem cell therapy experience in China which resulted in an article published by the Lancet Neurology in February 2008.
The Nature Biotechnology article which is entitled "Trading on Hope" is a followup to her investigation of "the thriving business of selling stem cell transplants as cure-alls for debilitating diseases." Jane has graciously made available a copy of her article to us.
Please click on the link, TradingonhopeNatureBiotech9-09.pdf, here.
Furthermore, Jonathan Kimmelman, who holds a PhD in Molecular Biophysics and Biochemistry from Yale University and is currently with the Biomedical Ethics Unit Faculty at the McGill University in Montreal, Canada, commented on Jane's article in his blog (Lost in Translation) post of September 23, 2009.
The Nature Biotechnology article which is entitled "Trading on Hope" is a followup to her investigation of "the thriving business of selling stem cell transplants as cure-alls for debilitating diseases." Jane has graciously made available a copy of her article to us.
Please click on the link, TradingonhopeNatureBiotech9-09.pdf, here.
Furthermore, Jonathan Kimmelman, who holds a PhD in Molecular Biophysics and Biochemistry from Yale University and is currently with the Biomedical Ethics Unit Faculty at the McGill University in Montreal, Canada, commented on Jane's article in his blog (Lost in Translation) post of September 23, 2009.
Friday, October 2, 2009
Perchance to dream
On our last visit with Dr. Susan Perlman at UCLA, Richard had complained about how he was suffering from parasomnia. He has experienced, on a regular basis, night terrors, sleep talking, bruxism and periodic leg movement. He has even fallen out of bed several times as a result of his nightmares. Needless to say, the quality of his sleep was less than satisfactory in general.
After consulting with her colleague, Dr. Perlman prescribed melatonin, which is OTC, to address the issue. We are happy to report that after taking this drug for a few months, the symptoms have abated. He is now sleeping more soundly which in turn translates to more energy during the day.
I continue to be gratified by how Dr. Perlman is able to tackle problems that plague Richard and other MJDers by using existing drugs or supplements. For example, melatonin is used mainly to help with circadian rhythm disorders like jet-lag disorders. Similarly, she suggested Fluoxetine (trade name Prozac) to help Richard with swallowing and choking problems and that too has worked well in the last two years. I hope and believe that there are many more drugs and supplements out there that one day will be shown to be equally effective in treating various MJD symptoms.
After consulting with her colleague, Dr. Perlman prescribed melatonin, which is OTC, to address the issue. We are happy to report that after taking this drug for a few months, the symptoms have abated. He is now sleeping more soundly which in turn translates to more energy during the day.
I continue to be gratified by how Dr. Perlman is able to tackle problems that plague Richard and other MJDers by using existing drugs or supplements. For example, melatonin is used mainly to help with circadian rhythm disorders like jet-lag disorders. Similarly, she suggested Fluoxetine (trade name Prozac) to help Richard with swallowing and choking problems and that too has worked well in the last two years. I hope and believe that there are many more drugs and supplements out there that one day will be shown to be equally effective in treating various MJD symptoms.
Wednesday, September 30, 2009
The latest research on MJD/SCA3
Here's an article from PloS ONE where researchers are trying to understand the behavior and movement of material of the nucleus (center) of the cell of someone who has MJD. Ataxin-3, I believe is the mutated genetic material within an MJDer's body cells that causes the ataxia. With a clearer picture as to how the "bad stuff" gets transported into the cells, the researchers can then think of and experiment with different ways in preventing that from happening.
It is a very technical article. I am nowhere close to even understanding 10% of what is written. Nevertheless, for those who are interested in learning more about this subject, here is the article in its entirety:
PLoS ONE. 2009; 4(6): e5834.
Published online 2009 June 8. doi: 10.1371/journal.pone.0005834.
PMCID: PMC2688764
Copyright Macedo-Ribeiro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Nucleocytoplasmic Shuttling Activity of Ataxin-3
Sandra Macedo-Ribeiro,#1* LuÃsa Cortes,#2 PatrÃcia Maciel,3 and Ana LuÃsa Carvalho2,4*
1IBMC-Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal
2Center for Neuroscience and Cell Biology (CNC), University of Coimbra, Coimbra, Portugal
3Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Braga, Portugal
4Department of Zoology, University of Coimbra, Coimbra, Portugal
David C. Rubinsztein, Editor
University of Cambridge, United Kingdom
#Contributed equally.
* E-mail:sribeiro@ibmc.up.pt (SMR);Email: alc@cnc.cj.uc.pt (ALC)
Conceived and designed the experiments: SMR PM ALC. Performed the experiments: LC ALC. Analyzed the data: SMR LC ALC. Contributed reagents/materials/analysis tools: PM. Wrote the paper: SMR LC ALC.
Received March 4, 2009; Accepted May 8, 2009.
Top
>Abstract
Introduction
Methods
Results and Discussion
References
Abstract
Spinocerebellar ataxia type-3, also known as Machado-Joseph Disease (MJD), is one of many inherited neurodegenerative disorders caused by polyglutamine-encoding CAG repeat expansions in otherwise unrelated genes. Disease protein misfolding and aggregation, often within the nucleus of affected neurons, characterize polyglutamine disorders. Several evidences have implicated the nucleus as the primary site of pathogenesis for MJD. However, the molecular determinants for the nucleocytoplasmic transport of human ataxin-3 (Atx3), the protein which is mutated in patients with MJD, are not characterized.
In order to characterize the nuclear shuttling activity of Atx3, we performed yeast nuclear import assays and found that Atx3 is actively imported into the nucleus, by means of a classical nuclear localizing sequence formed by a cluster of lysine and arginine residues. On the other hand, when active nuclear export was inhibited using leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, both endogenous Atx3 and transfected GFP-Atx3 accumulated inside the nucleus of a subpopulation of COS-7 cells, whereas both proteins are normally predominant in the cytoplasm.
Additionally, using a Rev(1.4)-GFP nuclear export assay, we performed an extensive analysis of six putative aliphatic nuclear export motifs identified in Atx3 amino acid sequence. Although none of the tested peptide sequences were found to drive nuclear export when isolated, we have successfully mapped the region of Atx3 responsible for its CRM1-independent nuclear export activity. Curiously, the N-terminal Josephin domain alone is exported into the cytoplasm, but the nuclear export activity of Atx3 is significantly enhanced in a longer construct that is truncated after the two ubiquitin interaction motifs, upstream from the polyQ tract.
Our data show that Atx3 is actively imported to and exported from the cell nucleus, and that its nuclear export activity is dependent on a motif located at its N-terminal region. Since pathological Atx3 aggregates in the nucleus of affected neurons in MJD, and there is in vivo evidence that nuclear localization of Atx3 is required for the manifestation of symptoms in MJD, defects in the nucleocytoplasmic shuttling activity of the protein may be involved in the nuclear accumulation and aggregation of expanded Atx3.
Top
Abstract
>Introduction
Methods
Results and Discussion
References
Introduction
Machado-Joseph disease (MJD), or spinocerebellar ataxia type 3, is the most common dominantly inherited ataxia worldwide and it is caused by a polyglutamine (polyQ) expansion in ataxin-3 (Atx3), a polyubiquitin-binding protein [1] with ubiquitin protease activity [2]. Full-length Atx3 contains an N-terminal Josephin domain (JD), the conserved catalytic module, two ubiquitin interacting motifs (UIMs), an expandable polyQ stretch, and a short variable tail that might contain a third UIM depending on the splice variant [3]. In normal individuals the size of the polymorphic glutamine repeat can range between 14 and 40 while in MJD patients the polyQ repeat is expanded to 53 or more glutamines [4]. Human Atx3 is ubiquitously expressed and displays a complex subcellular distribution involving both the cytoplasm and the nucleus, depending on cell type [5], [6], [7]. Even though its physiological role is still not clearly established, Atx3 was shown to be a cysteine protease with the ability to cleave polyubiquitin chains with more than four ubiquitins, independently of the polyglutamine tract [2]. This enzymatic activity of Atx3 has been correlated with its ability to mitigate polyQ-induced neurodegeneration in a Drosophila model [8], with its involvement in aggresome formation [9] and in the degradation of misfolded proteins [10]. Furthermore, it was also shown to bind to histones [11] and to chromatin [12] indicating that Atx3 displays not only cytoplasmic but also nuclear functions.
As for most other polyQ diseases, conformational changes imparted by the expanded polyQ tract lead to the formation of neuronal intranuclear inclusions (NIIs) [13] and may contribute to pathogenesis by affecting gene expression [14] or by disrupting nuclear organization and function [15]. In MJD patients specific brain regions are affected such as the cerebellum and brainstem, with prominent cell loss in the pontine and dentate nuclei [6], [16], [17]. It is becoming clear that although polyQ tracts themselves are toxic, the sequence and structure of the proteins carrying the polyQ tracts have important roles in defining the course and specificity of the disease. Those sequences determine subcellular localization, and specify interactions with other macromolecules within the cell, strongly determining the differences in the specificity of neuronal degeneration characteristic of polyQ disorders [18], [19], [20].
A contentious question has been whether polyQ-induced pathogenesis is primarily activated in the cytoplasm or in the cell nucleus. In fact predominantly nuclear inclusions have been found in SCA1, SCA2, SCA7, SCA17, DRPLA, SBMA, and Huntington's Disease (HD) patients [21], although cytoplasmic inclusions have also been identified in affected brain regions in SCA2 [22] and HD [23]. Evidence from HD transgenic mice shows that both nuclear and cytoplasmic exon-1 huntingtin might contribute to disease progression [23], [24], [25]. Nuclear environment has been shown to favor toxicity, pathology and aggregation as evidenced by nuclear targeting of polyQ peptides [26], even when inserted into ectopic protein contexts [27].
Specific nuclear localization sequences (NLS) have been identified in proteins carrying the expanded polyQ tracts, such as ataxin-1 [28], [29] and ataxin-7 [30], and nuclear-associated mechanisms are being implicated in neuropathogenesis [13], [31]. Similarly, nuclear export sequences (NES) have been found in ataxin-7 [32] and huntingtin [33] and it was shown that polyQ expansion impairs efficient nuclear export of these polyQ-containing proteins [32], [34].
Recently, it was demonstrated in vivo that adding an exogenous NLS to Atx3(148Q) increases the severity of the phenotype and induces earlier death in transgenic mouse models [35]. Accordingly, adding an exogenous NES to Atx3(148Q) drives the expanded protein out of the nucleus and prevents the manifestation of a phenotype [35]. This suggests that defects on the nucleocytoplasmic shuttling activity of the expanded protein might be correlated with pathology and neuronal specificity. Moreover, in other transgenic models of Machado-Joseph disease there is accumulation of the expanded Atx3 protein in the nucleus of affected neurons [36], [37], [38]. However, the molecular determinants for the nucleocytoplasmic transport of Atx3 are not characterized. In order to gain further insights into the function of Atx3 and into the disease-specific mechanisms of neurodegeneration in MJD, we have set as our goal the identification of the determinants of Atx3 nucleocytoplasmic transport.
Nuclear targeting was analyzed in vivo using the yeast system developed by Rhee et al. [39] and we found that Atx3 is actively imported into the nucleus, by means of a classical NLS located in its C-terminal region. Furthermore, using an in vivo nuclear export assay we show that Atx3 is actively exported from the nucleus and mapped this export activity to its N-terminal domain.
Top
Abstract
Introduction
>Methods
Results and Discussion
References
Methods
Yeast nuclear import assay
The yeast nuclear import assay was performed as described previously [39]. The cDNA encoding the MJD1.a isoform of ataxin-3 (AAB33571), containing 28 CAG repeats, was amplified by PCR using the pEGFP-C1-ataxin-3(28Q) construct (kindly provided by Dr. Henry Paulson) as template and using the primers 5′tcccccgggcatggtgagcaagggcg3′ and 5′gcgtcgacttatgtcagataaagtgtgaag3′, which introduced SmaI and SalI recognition sites at the 5′ and 3′ ends of the amplified DNA fragment, respectively. The cDNA encoding ataxin-3(28Q) was cloned into the SmaI and SalI sites of the plasmid for the yeast nuclear import assay (pNIA, kindly provided by Vitaly Citovsky [39]), and named pNIA-GFP-Atx3. The pNIA-GFP-Atx3R282T and pNIA-GFP-Atx3R282A constructs were obtained by site-directed mutagenesis (QuickChange site-directed mutagenesis kit, Stratagene).
The pNIA constructs, encoding triple fusion proteins comprising bacterial LexA, yeast Gal4p activation domain (Gal4AD), and the tested protein, were transformed using the lithium acetate method [40] into Saccharomyces cerevisiae L40 strain, which contains the reporter genes HIS3 and lacZ with upstream LexA operators. After transformation, yeasts were plated on selective medium deficient for tryptophan, to select for transformed cells. Transformed yeasts were then plated on selective medium lacking both tryptophan and histidine, and supplemented with 100 mM 3-amino-1,2,4-triazole (3AT; Sigma), an inhibitor of the His3p enzyme, and growth was evaluated. Additionally, transformed yeasts were grown in tryptophan-deficient liquid medium for quantitative determination of β-galactosidase activity [41]. For the enzymatic assay, cells were disrupted, and the β -galactosidase substrate o-nitrophenyl-β-D-galactopyranoside (ONPG) was added in excess. The reaction occurred at 30°C and was stopped by raising the pH to 11. The optical density of the reaction product was measured at 420 nm (OD420), and the β-galactosidase activity was calculated according to the following equation: βunits = 1,000×OD420/t×V×OD600, where OD420 is the optical density at 420 nm of the sample measured after the incubation of yeast cell lysate with ONPG, t is the time of incubation (in minutes) of the yeast cell lysate with ONPG, V is the volume of the sample used in the assay (in milliliters), and OD600 is the optical density at 600 nm of the yeast cell culture at the start of the assay.
Cell culture, transfection and leptomycin B treatment
HEK293 and COS-7 cells were grown and maintained in Dulbecco's modified Eagle's medium-high glucose (DMEM-HG; Sigma) supplemented with 10% (vol/vol) heat-inactivated fetal bovine serum (FBS; Biochrom KG) and with 100 U of penicillin and 100 µg of streptomycin (Sigma) per ml in a 5% CO2 humidified atmosphere at 37°C.
One day prior to transfection, COS-7 cells were seeded onto glass coverslips on a 12-well plate, at a subconfluent density. Transfection experiments were performed using Lipofectamine reagent (Invitrogen) according to the manufacturer's instructions, using 1 µg of plasmid DNA per well. The cells were incubated for 48 hours to allow gene expression.
Where indicated, the cells were incubated with 20 ng/ml leptomycin B (Sigma) in DMEM-HG supplemented with 10% FBS for 3 hours prior to fixation.
Rev(1.4)-GFP nuclear export assay
To assess the strength of the nuclear export activity of different fragments of Atx3 protein, or of full-length Atx3, the Rev(1.4)-GFP nuclear export assay, described previously by Henderson and Eleftheriou [42], was used. This assay is based on the manipulation of the Rev protein shuttling cycle, and tests for the ability of functional nuclear export sequences to promote the nuclear export activity of the Rev(1.4)-GFP fusion protein, which is composed of a NES-deficient mutant of the HIV-1 Rev protein and GFP.
Potential Atx3 NES signals were identified by consensus to the ΦX1–3ΦX2–3ΦXΦ motif (Φ indicates a large hydrophobic residue, and X indicates any amino acid), and using the prediction algorithm NetNES (http://www.cbs.dtu.dk/databases/NESbase-1.0 [43]), and fused to Rev(1.4)-GFP fusion protein (the plasmid encoding Rev(1.4)-GFP was kindly provided by Beric R. Henderson). The putative sequences that were assayed include: NES1, residues 76-SIQVISNALKVWGLELILF-94; NES2, 133-LNSLLT-138; NES3, 142-LISDTYLALFLAQLQQE-158; NES4, 174-ADQLLQMIRV-183; NES5, 209-LERVLE-214; and NES6, 222-LDEDEEDLQRALALSRQEIDME-243. Furthermore, full-length Atx3 (28Q and 84Q) or partial domains of Atx3 (the Josephin domain and the domains comprising amino acids 1–263 and 183–263) were also fused to Rev(1.4)-GFP fusion protein.
COS-7 cells were transfected with pRev(1.4)-GFP (negative control) or its derivative plasmids containing either the NES of the HIV-1 Rev protein (positive control) or each of the sequences to be tested. Forty-eight hours post-transfection, all cell samples were treated with 10 µg/ml cycloheximide (CHX) to ensure that any cytoplasmic GFP fluorescence resulted only from the nuclear export of GFP fusion proteins and not from de novo protein synthesis. Simultaneously, part of the cell samples were also treated for 3 hours with 5 µg/ml actinomycin D (ActD), which is known to specifically block the nuclear import of Rev protein by a mechanism not yet elucidated [42]. The remaining cell samples were treated with CHX, ActD and 20 ng/ml of leptomycin B for 3 hours. The subcellular localization of each GFP fusion protein was determined in at least 200 cells per experimental condition from three independent experiments.
Fluorescence microscopy
Endogenous Atx3 was detected, by immunocytochemistry, with anti-MJD antibody (1[ratio]10000), kindly provided by H. Paulson, and visualized using a secondary antibody labeled with Alexa 488 (1[ratio]1000, Invitrogen). For fluorescence analysis of GFP fusion proteins, cells were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde: 4% sacarose for 15 min, and rinsed with PBS. The coverslips were then inverted and mounted on glass slides with Vectashield mounting medium (Vector Laboratories). The cell nucleus was stained with Hoescht 33342 (0,5 µg/ml, Molecular Probes). Fluorescence observations were performed using a Zeiss Axiovert 200 fluorescence microscope, coupled to a digital photographic camera (Axiocam HRM). Confocal microscopy was performed using a Zeiss LSM 510 Meta system.
Top
Abstract
Introduction
Methods
>Results and Discussion
References
Results and Discussion
Ataxin-3 has a mixed cytoplasmic and nuclear distribution
Ataxin-3 is an ubiquitous protein that is found both in the cytoplasm [44] and in the nucleus [5], [7]. However, upon expansion of the polyQ tract the protein forms insoluble inclusions predominantly located inside the nucleus of the affected cells [6]. Interestingly, the localization of the protein inside the cell is critically dependent on the cell type [5], [7]. Immunostaining of HEK293T cells with an anti-Atx3 antibody (kindly provided by H. Paulson [6]) showed that endogenous Atx3 is predominantly located in the nucleus (Fig. 1aFigure 1), while its distribution is more homogeneous in COS-7 cells (Fig. 1cFigure 1). Interestingly, when both cell lines were transiently transfected with Atx3 N-terminally tagged with GFP (GFP-Atx3 (28Q), Figs. 1e and 1gFigure 1), Atx3 was found predominantly in the cytoplasm of both cell types, in agreement with previous data [5], [6], [45].
Figure 1
Figure 1
Figure 1
Ataxin-3 can shuttle between the nucleus and the cytoplasm.
In order to determine whether Atx3 can be actively transported across the nuclear membrane we analyzed the effect of leptomycin B, a specific covalent inhibitor of the nuclear export factor CRM1/exportin [46], [47], on the subcellular distribution of both endogenous and overexpressed Atx3 in HEK293 and COS-7 cell lines. In eukaryotic cells, nuclear export of proteins is frequently mediated by this nuclear export factor, which binds to nuclear export signals (NES) on cargo molecules. If Atx3 is a nuclear shuttling protein, interfering with its putative nuclear export would be expected to modify Atx3 subcellular localization by increasing the proportion of the protein localized in the nucleus. Indeed, after cell treatment with leptomycin B both endogenous Atx3 (Figs. 1b and fFigure 1) and transfected GFP-Atx3 (28Q) (Figs. 1d, hFigure 1) accumulate in the nucleus of a subpopulation of cells, suggesting that Atx3 exits the cell nucleus by active transport at least partially dependent on the CRM1/exportin pathway. In COS-7 cells the nuclear accumulation of GFP-Atx3(28Q) could be observed in 26.5±4.5% of cells after leptomycin B treatment, whereas in untreated cells only 4.8±2.4% of cells showed nuclear accumulation of the protein. Nuclear export dependent on CRM1 receptor has also been demonstrated for other proteins containing expandable polyglutamine tracts such as ataxin-7 [32] and huntingtin [33]. In agreement with what is observed for Atx3 in the context of the full-length protein, leptomycin B treatment of cultured cells tranfected with huntingtin lead to a partial nuclear accumulation of the protein corresponding to a 10% increase in nuclear fluorescence of huntingtin [33].
Ataxin-3 contains a functional nuclear localization signal
Translocation of macromolecules larger than 40–60 kDa in and out of the nucleus is an active, energy-dependent process that is mediated by specific sequence motifs: nuclear localization signals (NLS) and nuclear export signals (NES). “Classical” examples of NLSs are the highly basic motifs originally found in the simian virus 40 (SV40) large T antigen and in nucleoplasmin, although several sequences differing from those basic ones have also been shown to function as NLS [48], [49], [50]. In “classical” nuclear import, importin-α recognizes and binds the target proteins in the cytoplasm, mediating their transport across the nuclear pore complex after formation of a ternary complex with importin-β [48], although some NLS-containing cargoes can be directly recognized by importin-β without the need of the adaptor protein. Within importin-α, the major NLS binding pocket contains a series of negatively charged residues that form salt bridges with the basic residues within the NLS sequences [51]. A putative NLS has been identified within the amino acid sequence of Atx3 [5], which is conserved among Atx3 proteins from diverse species (Fig. 2Figure 2).
Figure 2
Figure 2
Figure 2
Human ataxin-3 and its closest homologues contain conserved nuclear import sequences.
In order to test the functionality of the identified NLS sequence, we used a pNIA vector-based genetic one-hybrid system that allows identification of nuclear proteins in yeast cells [39]. This assay is based on the functional outcome of the nuclear import of the tested protein, which, if it reaches the yeast cell nucleus, allows specific induction of a reporter gene. The advantage of this approach is allowing the quantitative evaluation of the strength of the nucleocytoplasmic shuttling signals, independently of the cellular model. This system has been consistently used for mutational analysis of nuclear proteins to delineate and characterize the NLS [52] and for testing the integrity of the nuclear pore complex permeability barrier [53]. The rationale for this assay is the expression in the yeast S. cerevisiae cells of the test protein fused to a modified LexA DNA binding domain (DBD) and the Gal4 transcriptional activation domain (AD). This transcription based assay relies on the ability of a functional NLS to allow the chimera to enter the yeast nucleus and activate transcription of a LexA responsive β-galactosidase or HIS3 reporter gene. In the absence of a functional NLS, the fusion protein is not efficiently imported into the nucleus, and is unable to activate transcription. As a result, this assay provides a simple measure of NLS function based either on the quantitative determination of β-galactosidase activity or on the qualitative analysis of yeast growth in a medium lacking histidine. This system is not limited to the identification of yeast NLSs, as the nuclear import apparatus is highly conserved between yeast and higher eukaryotic cells [49], [50].
pNIA-GFP and pNIA-SV40NLS were used as controls for the nuclear import assay. pNIA-GFP encodes the fusion protein mLexA-Gal4AD-GFP and was used as negative control because it is not imported into the nucleus, resulting in minimal expression of the two reporter genes, whereas pNIA-SV40NLS encodes the fusion protein mLexA-SV40NLS-Gal4AD-GFP which, due to the presence of the SV40NLS, is actively imported into the nucleus, leading to high activity of both lacZ and HIS3 genes. The cDNA for ataxin-3 (with 28 glutamines) was cloned in the pNIA vector, and to ensure that the resulting fusion protein had a molecular weight not compatible with simple diffusion across the nuclear pore, GFP was inserted between Gal4AD and Atx3. When expressed in yeast, the pNIA-GFP-Atx3 fusion protein induced growth on histidine-deficient medium (data not shown), suggesting that Atx3 was actively imported into the nucleus. To confirm this result we performed a quantitative β-galactosidase assay, in liquid culture of yeast cells expressing the different constructs (Fig. 3Figure 3). The results obtained show that pNIA-GFPAtx3 induced levels of β-galactosidase activity significantly higher than the levels obtained for pNIA-GFP, a finding which confirms that Atx3 is actively imported into the nucleus of yeast cells.
Figure 3
Figure 3
Figure 3
Evaluation of the nuclear import capacity of ataxin-3 protein in yeast.
To determine whether the proposed NLS of Atx3 was indeed responsible for the translocation of the fusion protein into the nucleus of yeast cells, we mutated the conserved arginine residue within the putative NLS sequence into a threonine residue (pNIA-GFP-Atx3R282T). This mutation is a typical mutation performed in the analysis of conserved NLS sequences since it changes a basic residue for a neutral residue without modifying its polar character [28], and has also been shown to disrupt the function of the NLS identified in ataxin-1 and ataxin-7 [28], [30]. As shown in Figure 3Figure 3, the mutation results in the reduction the β-galactosidase activity to levels similar to the negative control (pNIA-GFP), indicating that the mutation greatly impairs Atx3 nuclear import in yeast. The mutation of the same arginine residue to an alanine residue (pNIA-GFP-Atx3R282A) was also tested, and resulted in a reduction on the nuclear accumulation of the fusion protein (Fig. 3Figure 3). These data show that interference with the putative NLS disrupts the nuclear import ability of Atx3.
The nuclear import activity of Atx3 was further confirmed in mammalian cells by comparing the subcellular localization of GFP-Atx3(28Q)R282T with GFP-Atx3(28Q) (Fig. 4Figure 4). When transfected in COS-7 cells, both constructs localized mainly in the cytoplasm of the cells. Because our data show that Atx3 can also be exported from the nucleus and that this export is at least partially mediated by the CRM1 pathway (see above), the similar localization of wild-type Atx3 and the R282T mutant might be due to the presence of competitive nuclear export signals. Therefore, in order to investigate if there is a difference between the nuclear shuttling ability of the wild-type protein and the R232T mutant in COS-7 cells, we incubated the cells with leptomycin B, thereby at least partially inhibiting nuclear export, and determined their subcellular re-localization. As shown in Fig. 1Figure 1 (panels g and h), GFP-Atx3(28Q) accumulates in the nucleus of a subpopulation of cells in the presence of leptomycin B. When GFP-Atx3(28Q)R282T is expressed in COS-7 cells this nuclear accumulation is not observed (Fig. 4Figure 4), indicating that the identified NLS sequence is also responsible for driving Atx3 into the nucleus of mammalian cells. Therefore, we conclude that Atx3 contains a basic NLS sequence that is functional and promotes its active import into the cell nucleus.
Figure 4
Figure 4
Figure 4
Evaluation of the nuclear import ability of ataxin-3 in mammalian cells.
The nuclear export of ataxin-3 is mediated by CRM1-dependent and -independent pathways
Since the nuclear export of Atx3 was partially inhibited in the presence of leptomycin B (Figs. 1Figure 1, ,4),4Figure 4), we analyzed the nuclear export activity of Atx3 using the Rev(1.4)-GFP nuclear export assay [42]. This assay is based on the expression of fusion proteins consisting of Rev(1.4), an export-defective HIV-1 Rev protein mutant, the sequence to be tested, and GFP. The nuclear export functionality of the sequence to be tested is evaluated by analyzing its capacity to promote nuclear export of the Rev(1.4)-GFP fusion protein. The Rev(1.4)-GFP fusion protein, which was used as a negative control for this assay, was localized exclusively in the nucleus of COS-7 cells, presenting a clear nucleolar accumulation (Fig. 5bFigure 5). Rev(1.4)-NES–GFP, a fusion protein that contains the Rev NES, which was used as a positive control for this assay, was localized in the nucleus and the cytoplasm of transfected cells (Fig. 5bFigure 5). The number of cells presenting exclusively cytoplasmic localization was enhanced following actinomycin D (ActD) treatment (Fig. 5bFigure 5), which blocks the nuclear import mediated by the Rev NLS [42], whereas the cytoplasmic localization of Rev(1.4)-NES-GFP was completely blocked by addition of leptomycin B (Fig. 5bFigure 5), as expected for a protein whose nuclear export is dependent on CRM1.
Figure 5
Figure 5
Figure 5
The nuclear export of ataxin-3 is mediated by the protein N-terminal domain.
Full-length Atx3 containing 28 glutamine residues [Atx3(28Q)], when fused to Rev(1.4)-GFP, was driven into the nucleus, where it formed punctuate structures resembling the insoluble nuclear inclusions (Fig. 5bFigure 5). The morphology of these structures is clearly distinct from the nucleolar accumulation of fluorescence observed for Rev(1.4)-GFP (Fig. 5bFigure 5). We also tested full-length Atx3 containing 84 glutamine residues [Atx3(84Q), Fig. 5bFigure 5], which formed punctuate structures, presumably aggregates, in the nucleus of transfected cells. These structures were not sensitive to the blockade of nuclear import of the Rev fusion protein using ActD. In fact, this result is in agreement with previous observations that Atx3 has a tendency to oligomerize independently of the expanded polyQ tract [54], [55], [56] and that the nuclear environment promotes protein misfolding and aggregation [57]. Curiously, it was observed that overexpression of ataxin-7 in cell culture models induced the nuclear localization of the protein and formation of large protein “accumulations” in ~30% of the cells, independently of the polyglutamine tract size [30].
The nuclear aggregation of full-length Atx3 when fused to Rev(1.4)-GFP, independently of the extent of the polyQ tract, presumably triggered by the strong Rev NLS, hampered the investigation of the nuclear export activity of full-length Atx3 using this system. Therefore, we prepared constructs encoding various domains of Atx3 fused to Rev(1.4)-GFP, all lacking the polyglutamine tract and the endogenous NLS (Fig. 5aFigure 5). The fusion protein consisting of the Josephin domain of Atx3 [JD-(1–182)] fused to Rev(1.4)-GFP showed a distribution between the cell nucleus and cytoplasm in 46% of the cells after cell treatment with ActD (Fig. 5bFigure 5). We also tested the cellular localization of the fusion protein consisting of the Josephin domain followed by the segment of Atx3 that contains the UIMs [Atx3(1–263)], fused to Rev(1.4)-GFP [Rev1.4-Atx3(1–263)-GFP]. This protein also displayed a nuclear and cytoplasmic localization, and the number of cells showing a mixed distribution of the protein increased to 78% after cell treatment with ActD (Fig. 5bFigure 5). The nuclear export activities of JD(1–182) and Atx3(1–263) were not inhibited by the CRM1 export inhibitor leptomycin B (+LMB).
These results suggest that the Josephin domain can mediate the nuclear export of the fusion proteins, which requires the context of the Josephin domain plus a sequence downstream this catalytic region. However, this UIM-containing segment alone [Rev(1.4)-Atx3(183–263)-GFP, Fig. 5bFigure 5] was not sufficient to promote nuclear export of the fusion protein. Finally, we asked whether the nuclear export of the Atx3(1–263) fragment was dependent on the ubiquitin binding capacity of its UIMs. It has been shown, in a cell-based assay of polyQ aggregation, that recruitment of non-expanded Atx3 into nuclear aggregates is mediated by its UIMs [58]. Therefore, we mutated the two UIMs in the Atx3(1–263) fragment in order to compromise their functionality [Atx3(1–263)(S236A,S256A)]. This protein had the same pattern of cellular distribution as the wild-type Atx3(1–263) fragment (Fig. 5bFigure 5), indicating that functionality of the UIMs is not required for the increased nuclear export activity observed for this region of Atx3.
Our results clearly demonstrate that nuclear export of Atx3 is dependent on a complex Atx3 motif, located in the N-terminal portion of the protein, which requires the context of the Josephin domain plus the ubiquitin-interacting motifs. Taken together, these data indicate either that nuclear export of Atx3 is mediated by a nuclear export receptor that recognizes a properly folded conformational motif and/or that multiple export pathways contribute to the overall nuclear export of full-length Atx3. Interestingly, a nuclear export receptor, exportin 7, has been recently described, which recognizes nuclear export signals that include conformation-dependent recognition motifs, rather than short linear sequences [59].
Since we observed nuclear accumulation of Atx3 in a population of COS-7 cells when the CRM1 transporter was inhibited with leptomycin B (Figs. 1Figure 1 and and4),4Figure 4), we looked for leucine-rich nuclear export signal (NES) sequences within Atx3 primary structure that might match the consensus NES sequence for the CRM1-dependent export [60], using the NetNES predictor (http://www.cbs.dtu.dk/databases/NESbase-1.0 [43]). We found 6 putative NES sequences, of which 4 are present within the Josephin domain (Fig. 2Figure 2, NES1-NES4), one is located between the Josephin domain and the first ubiquitin interaction domain (NES5) and the last one (NES6) corresponds to the first ubiquitin interaction motif of the protein (Fig. 2Figure 2). We have fused the putative NESs identified in Atx3 with Rev(1.4)-GFP, and tested whether the presence of these sequences can induce the translocation of Rev(1.4)-GFP from the cell nucleus. However, the isolated NES sequences failed to induce nuclear export when inserted into the Rev(1.4)-GFP vector (Table 1). The observation that in this system none of the tested sequences showed nuclear export activity can result from the fact that these sequences do not function as active leucine-rich nuclear export signals, but could also be a consequence of testing the sequences isolated from their overall protein context. For example, the isolated NES of Rev binds to CRM1 much more weakly than does the full-length Rev protein [61], implying that an NES may require flanking sequences to adopt the conformation needed for CRM1 binding. Another possibility is that each isolated sequence is not strong enough to drive detectable nuclear export of Rev1.4-GFP, which has a very strong NLS, and that several NESs work in concert to achieve efficient export of Atx3. In fact, recent studies show that most NESs bind to CRM1 with relatively low affinity, since high-affinity NES binding to CRM1 impairs the efficient release of export complexes from the nuclear pore complex [60].
Table 1
Table 1
Analysis of the nuclear export activity of putative NES sequences within ataxin-3 primary structure.
The nuclear export of GFP-Atx3(28Q) was partially inhibited by leptomycin B (Figs. 1Figure 1, ,4),4Figure 4), suggesting that a CRM1-dependent pathway is involved in the nuclear export of Atx3. On the other hand, using the Rev(1.4)-GFP fusion system, which contains a strong NLS, we detected nuclear export activity of the N-terminal portion of Atx3 (Josephin domain and UIMs) that was not sensitive to leptomycin B (Fig. 5bFigure 5). This supports the possibility that, in resemblance to what has been found for huntingtin [33], [34], CRM1-dependent and -independent nuclear export mechanisms coexist to cooperate in determining the subcellular distribution of Atx3. In the context of the full-length protein, one of these pathways may be dominant when compared to the other. Similar to that of Atx3 and huntingtin, the nuclear export of other proteins, such as α-catenin [62], receptor-interacting protein 3 (RIP3) [63] and the African Swine Fever Virus p37 protein [64], has been shown to be mediated by both CRM1-dependent and –independent pathways.
Conclusion
A correlation between the nuclear environment and protein aggregation in MJD models has been pinpointed by studies using Atx3 with an exogenously added NLS that demonstrated in situ that the nuclear environment drives aggregation of both expanded and non-expanded Atx3 [57], [65]. Recent in vivo studies have shown that adding an exogenous NES does not only suppress the formation of NIIs almost completely, but also seems to prevent the aggregation of Atx3 [35]. Furthermore, live-cell imaging studies showed that expanded polyQ tracts slow the dynamics of intact Atx3, and that the export of expanded Atx3 is less efficient than the export of normal Atx3 [66], suggesting a defect on the nucleocytoplasmic shuttling activity of the expanded protein. In fact, a recent study using a Drosophila system to screen for genetic modifiers of Atx3 neurodegeneration identified as a suppressor of Atx3-mediated toxicity, among others, the gene encoding the nuclear export protein Embargoed, the orthologue of human CRM1 [67]. In order to further understand the link between nuclear localization, aggregation and toxicity of expanded Atx3, it is essential to identify the mechanisms behind the intracellular dynamics of the normal protein. In this study, we have confirmed the functionality of the putative Atx3 NLS in yeast and mammalian cells, and detected CRM1-dependent and –independent pathways that mediate the nuclear export of Atx3. Our data show that the CRM1-independent nuclear export of Atx3 is mediated by the N-terminal region of the protein and is critically dependent on a three-dimensional motif whose integrity is compromised when the Josephin domain is physically separated from the UIMs. Future identification of the nuclear transporter(s) responsible for this pathway, will pave the way to determining how the subcellular localization of Atx3 is regulated in physiological or pathological conditions.
Acknowledgments
We are grateful to Henry Paulson for providing the pEGFP-C1-ataxin-3(28Q) plasmid, as well as the anti-ataxin-3 antibody, to Vitaly Citovsky for providing the pNIA vector and the Saccharomyces cerevisiae L40 strain, and to Beric R. Henderson for providing the Rev(1.4)-GFP and the Rev(1.4)-NES-GFP plasmids. We thank Ana Eulálio and Maria C. Pedroso de Lima for helpful advice and discussions.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported by a grant from the Portuguese Foundation for Science and Technology (POCI/SAU-MMO/60156/2004) and by Crioestaminal/Associacao Viver a Ciencia. LC was a recipient of a post-doctoral fellowship from the Portuguese Foundation for Science and Technology (SFRH/BPD/20686/2004/22). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Top
Abstract
Introduction
Methods
Results and Discussion
References
References
1.
Chai Y, Berke SS, Cohen RE, Paulson HL. Poly-ubiquitin binding by the polyglutamine disease protein ataxin-3 links its normal function to protein surveillance pathways. J Biol Chem. 2004;279:3605–3611. [PubMed]
2.
Burnett B, Li F, Pittman RN. The polyglutamine neurodegenerative protein ataxin-3 binds polyubiquitylated proteins and has ubiquitin protease activity. Hum Mol Genet. 2003;12:3195–3205. [PubMed]
3.
Masino L, Musi V, Menon RP, Fusi P, Kelly G, et al. Domain architecture of the polyglutamine protein ataxin-3: a globular domain followed by a flexible tail. FEBS Lett. 2003;549:21–25. [PubMed]
4.
Maciel P, Costa MC, Ferro A, Rousseau M, Santos CS, et al. Improvement in the molecular diagnosis of Machado-Joseph disease. Arch Neurol. 2001;58:1821–1827. [PubMed]
5.
Tait D, Riccio M, Sittler A, Scherzinger E, Santi S, et al. Ataxin-3 is transported into the nucleus and associates with the nuclear matrix. Hum Mol Genet. 1998;7:991–997. [PubMed]
6.
Paulson HL, Perez MK, Trottier Y, Trojanowski JQ, Subramony SH, et al. Intranuclear inclusions of expanded polyglutamine protein in spinocerebellar ataxia type 3. Neuron. 1997;19:333–344. [PubMed]
7.
Trottier Y, Cancel G, An-Gourfinkel I, Lutz Y, Weber C, et al. Heterogeneous intracellular localization and expression of ataxin-3. Neurobiol Dis. 1998;5:335–347. [PubMed]
8.
Warrick JM, Morabito LM, Bilen J, Gordesky-Gold B, Faust LZ, et al. Ataxin-3 suppresses polyglutamine neurodegeneration in Drosophila by a ubiquitin-associated mechanism. Mol Cell. 2005;18:37–48. [PubMed]
9.
Burnett BG, Pittman RN. The polyglutamine neurodegenerative protein ataxin 3 regulates aggresome formation. Proc Natl Acad Sci U S A. 2005;102:4330–4335. [PubMed]
10.
Wang Q, Li L, Ye Y. Regulation of retrotranslocation by p97-associated deubiquitinating enzyme ataxin-3. J Cell Biol. 2006;174:963–971. [PubMed]
11.
Li F, Macfarlan T, Pittman RN, Chakravarti D. Ataxin-3 is a histone-binding protein with two independent transcriptional corepressor activities. J Biol Chem. 2002;277:45004–45012. [PubMed]
12.
Evert BO, Araujo J, Vieira-Saecker AM, de Vos RA, Harendza S, et al. Ataxin-3 represses transcription via chromatin binding, interaction with histone deacetylase 3, and histone deacetylation. J Neurosci. 2006;26:11474–11486. [PubMed]
13.
Ross CA, Wood JD, Schilling G, Peters MF, Nucifora FC, Jr, et al. Polyglutamine pathogenesis. Philos Trans R Soc Lond B Biol Sci. 1999;354:1005–1011. [PubMed]
14.
Zoghbi HY, Orr HT. Glutamine repeats and neurodegeneration. Annu Rev Neurosci. 2000;23:217–247. [PubMed]
15.
Sun J, Xu H, Negi S, Subramony SH, Hebert MD. Differential effects of polyglutamine proteins on nuclear organization and artificial reporter splicing. J Neurosci Res. 2007;85:2306–2317. [PubMed]
16.
Sequeiros J, Coutinho P. Epidemiology and clinical aspects of Machado-Joseph disease. Adv Neurol. 1993;61:139–153. [PubMed]
17.
Schmidt T, Landwehrmeyer GB, Schmitt I, Trottier Y, Auburger G, et al. An isoform of ataxin-3 accumulates in the nucleus of neuronal cells in affected brain regions of SCA3 patients. Brain Pathol. 1998;8:669–679. [PubMed]
18.
Orr HT. Beyond the Qs in the polyglutamine diseases. Genes Dev. 2001;15:925–932. [PubMed]
19.
Paulson H. Polyglutamine neurodegeneration: minding your Ps and Qs. Nat Med. 2003;9:825–826. [PubMed]
20.
Lim J, Crespo-Barreto J, Jafar-Nejad P, Bowman AB, Richman R, et al. Opposing effects of polyglutamine expansion on native protein complexes contribute to SCA1. Nature. 2008
21.
Schols L, Bauer P, Schmidt T, Schulte T, Riess O. Autosomal dominant cerebellar ataxias: clinical features, genetics, and pathogenesis. Lancet Neurol. 2004;3:291–304. [PubMed]
22.
Huynh DP, Figueroa K, Hoang N, Pulst SM. Nuclear localization or inclusion body formation of ataxin-2 are not necessary for SCA2 pathogenesis in mouse or human. Nat Genet. 2000;26:44–50. [PubMed]
23.
DiFiglia M. Huntingtin fragments that aggregate go their separate ways. Mol Cell. 2002;10:224–225. [PubMed]
24.
Schilling G, Savonenko AV, Klevytska A, Morton JL, Tucker SM, et al. Nuclear-targeting of mutant huntingtin fragments produces Huntington's disease-like phenotypes in transgenic mice. Hum Mol Genet. 2004;13:1599–1610. [PubMed]
25.
Benn CL, Landles C, Li H, Strand AD, Woodman B, et al. Contribution of nuclear and extranuclear polyQ to neurological phenotypes in mouse models of Huntington's disease. Hum Mol Genet. 2005;14:3065–3078. [PubMed]
26.
Yang W, Dunlap JR, Andrews RB, Wetzel R. Aggregated polyglutamine peptides delivered to nuclei are toxic to mammalian cells. Hum Mol Genet. 2002;11:2905–2917. [PubMed]
27.
Jackson WS, Tallaksen-Greene SJ, Albin RL, Detloff PJ. Nucleocytoplasmic transport signals affect the age at onset of abnormalities in knock-in mice expressing polyglutamine within an ectopic protein context. Hum Mol Genet. 2003;12:1621–1629. [PubMed]
28.
Klement IA, Skinner PJ, Kaytor MD, Yi H, Hersch SM, et al. Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. Cell. 1998;95:41–53. [PubMed]
29.
Irwin S, Vandelft M, Pinchev D, Howell JL, Graczyk J, et al. RNA association and nucleocytoplasmic shuttling by ataxin-1. J Cell Sci. 2005;118:233–242. [PubMed]
30.
Kaytor MD, Duvick LA, Skinner PJ, Koob MD, Ranum LP, et al. Nuclear localization of the spinocerebellar ataxia type 7 protein, ataxin-7. Hum Mol Genet. 1999;8:1657–1664. [PubMed]
31.
Orr HT. Qs in the nucleus. Neuron. 2001;31:875–876. [PubMed]
32.
Taylor J, Grote SK, Xia J, Vandelft M, Graczyk J, et al. Ataxin-7 can export from the nucleus via a conserved exportin-dependent signal. J Biol Chem. 2006;281:2730–2739. [PubMed]
33.
Xia J, Lee DH, Taylor J, Vandelft M, Truant R. Huntingtin contains a highly conserved nuclear export signal. Hum Mol Genet. 2003;12:1393–1403. [PubMed]
34.
Cornett J, Cao F, Wang CE, Ross CA, Bates GP, et al. Polyglutamine expansion of huntingtin impairs its nuclear export. Nat Genet. 2005;37:198–204. [PubMed]
35.
Bichelmeier U, Schmidt T, Hubener J, Boy J, Ruttiger L, et al. Nuclear localization of ataxin-3 is required for the manifestation of symptoms in SCA3: in vivo evidence. J Neurosci. 2007;27:7418–7428. [PubMed]
36.
Alves S, Regulier E, Nascimento-Ferreira I, Hassig R, Dufour N, et al. Striatal and nigral pathology in a lentiviral rat model of Machado-Joseph disease. Hum Mol Genet. 2008;17:2071–2083. [PubMed]
37.
Chen X, Tang TS, Tu H, Nelson O, Pook M, et al. Deranged calcium signaling and neurodegeneration in spinocerebellar ataxia type 3. J Neurosci. 2008;28:12713–12724. [PubMed]
38.
Goti D, Katzen SM, Mez J, Kurtis N, Kiluk J, et al. A mutant ataxin-3 putative-cleavage fragment in brains of Machado-Joseph disease patients and transgenic mice is cytotoxic above a critical concentration. J Neurosci. 2004;24:10266–10279. [PubMed]
39.
Rhee Y, Gurel F, Gafni Y, Dingwall C, Citovsky V. A genetic system for detection of protein nuclear import and export. Nat Biotechnol. 2000;18:433–437. [PubMed]
40.
Kaiser C, Michaelis S, Mitchell A. Methods in yeast genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1994.
41.
Stachel SE, An G, Flores C, Nester EW. A Tn3 lacZ transposon for the random generation of beta-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium. Embo J. 1985;4:891–898. [PubMed]
42.
Henderson BR, Eleftheriou A. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp Cell Res. 2000;256:213–224. [PubMed]
43.
la Cour T, Gupta R, Rapacki K, Skriver K, Poulsen FM, et al. NESbase version 1.0: a database of nuclear export signals. Nucleic Acids Res. 2003;31:393–396. [PubMed]
44.
Paulson HL, Das SS, Crino PB, Perez MK, Patel SC, et al. Machado-Joseph disease gene product is a cytoplasmic protein widely expressed in brain. Ann Neurol. 1997;41:453–462. [PubMed]
45.
Chai Y, Koppenhafer SL, Shoesmith SJ, Perez MK, Paulson HL. Evidence for proteasome involvement in polyglutamine disease: localization to nuclear inclusions in SCA3/MJD and suppression of polyglutamine aggregation in vitro. Hum Mol Genet. 1999;8:673–682. [PubMed]
46.
Kudo N, Khochbin S, Nishi K, Kitano K, Yanagida M, et al. Molecular cloning and cell cycle-dependent expression of mammalian CRM1, a protein involved in nuclear export of proteins. J Biol Chem. 1997;272:29742–29751. [PubMed]
47.
Kudo N, Wolff B, Sekimoto T, Schreiner EP, Yoneda Y, et al. Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp Cell Res. 1998;242:540–547. [PubMed]
48.
Lange A, Mills RE, Lange CJ, Stewart M, Devine SE, et al. Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem. 2007;282:5101–5105. [PubMed]
49.
Pemberton LF, Paschal BM. Mechanisms of receptor-mediated nuclear import and nuclear export. Traffic. 2005;6:187–198. [PubMed]
50.
Sorokin AV, Kim ER, Ovchinnikov LP. Nucleocytoplasmic transport of proteins. Biochemistry (Mosc). 2007;72:1439–1457. [PubMed]
51.
Terry LJ, Shows EB, Wente SR. Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport. Science. 2007;318:1412–1416. [PubMed]
52.
Yang B, Zhu W, Johnson LB, White FF. The virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein. Proc Natl Acad Sci U S A. 2000;97:9807–9812. [PubMed]
53.
Patel SS, Belmont BJ, Sante JM, Rexach MF. Natively unfolded nucleoporins gate protein diffusion across the nuclear pore complex. Cell. 2007;129:83–96. [PubMed]
54.
Chow MK, Paulson HL, Bottomley SP. Destabilization of a non-pathological variant of ataxin-3 results in fibrillogenesis via a partially folded intermediate: a model for misfolding in polyglutamine disease. J Mol Biol. 2004;335:333–341. [PubMed]
55.
Gales L, Cortes L, Almeida C, Melo CV, do Carmo Costa M, et al. Towards a structural understanding of the fibrillization pathway in Machado-Joseph's disease: trapping early oligomers of non-expanded ataxin-3. J Mol Biol. 2005;353:642–654. [PubMed]
56.
Masino L, Nicastro G, Menon RP, Dal Piaz F, Calder L, et al. Characterization of the structure and the amyloidogenic properties of the Josephin domain of the polyglutamine-containing protein ataxin-3. J Mol Biol. 2004;344:1021–1035. [PubMed]
57.
Perez MK, Paulson HL, Pittman RN. Ataxin-3 with an altered conformation that exposes the polyglutamine domain is associated with the nuclear matrix. Hum Mol Genet. 1999;8:2377–2385. [PubMed]
58.
Donaldson KM, Li W, Ching KA, Batalov S, Tsai CC, et al. Ubiquitin-mediated sequestration of normal cellular proteins into polyglutamine aggregates. Proc Natl Acad Sci U S A. 2003;100:8892–8897. [PubMed]
59.
Mingot JM, Bohnsack MT, Jakle U, Gorlich D. Exportin 7 defines a novel general nuclear export pathway. Embo J. 2004;23:3227–3236. [PubMed]
60.
Kutay U, Guttinger S. Leucine-rich nuclear-export signals: born to be weak. Trends Cell Biol. 2005;15:121–124. [PubMed]
61.
Paraskeva E, Izaurralde E, Bischoff FR, Huber J, Kutay U, et al. CRM1-mediated recycling of snurportin 1 to the cytoplasm. J Cell Biol. 1999;145:255–264. [PubMed]
62.
Giannini A, Mazor M, Orme M, Vivanco M, Waxman J, et al. Nuclear export of alpha-catenin: overlap between nuclear export signal sequences and the beta-catenin binding site. Exp Cell Res. 2004;295:150–160. [PubMed]
63.
Yang Y, Ma J, Chen Y, Wu M. Nucleocytoplasmic shuttling of receptor-interacting protein 3 (RIP3): identification of novel nuclear export and import signals in RIP3. J Biol Chem. 2004;279:38820–38829. [PubMed]
64.
Eulalio A, Nunes-Correia I, Carvalho AL, Faro C, Citovsky V, et al. Nuclear export of African swine fever virus p37 protein occurs through two distinct pathways and is mediated by three independent signals. J Virol. 2006;80:1393–1404. [PubMed]
65.
Perez MK, Paulson HL, Pendse SJ, Saionz SJ, Bonini NM, et al. Recruitment and the role of nuclear localization in polyglutamine-mediated aggregation. J Cell Biol. 1998;143:1457–1470. [PubMed]
66.
Chai Y, Shao J, Miller VM, Williams A, Paulson HL. Live-cell imaging reveals divergent intracellular dynamics of polyglutamine disease proteins and supports a sequestration model of pathogenesis. Proc Natl Acad Sci U S A. 2002;99:9310–9315. [PubMed]
67.
Bilen J, Bonini NM. Genome-wide screen for modifiers of ataxin-3 neurodegeneration in Drosophila. PLoS Genet. 2007;3:1950–1964. [PubMed]
68.
Gouet P, Courcelle E, Stuart DI, Metoz F. ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics. 1999;15:305–308. [PubMed]
Articles from PLoS ONE are provided here courtesy of
Public Library of Science
Write to PMC | PMC Home | PubMed
NCBI | U.S. National Library of Medicine
NIH | Department of Health and Human Services
Privacy Policy | Disclaimer | Freedom of Information Act
It is a very technical article. I am nowhere close to even understanding 10% of what is written. Nevertheless, for those who are interested in learning more about this subject, here is the article in its entirety:
PLoS ONE. 2009; 4(6): e5834.
Published online 2009 June 8. doi: 10.1371/journal.pone.0005834.
PMCID: PMC2688764
Copyright Macedo-Ribeiro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Nucleocytoplasmic Shuttling Activity of Ataxin-3
Sandra Macedo-Ribeiro,#1* LuÃsa Cortes,#2 PatrÃcia Maciel,3 and Ana LuÃsa Carvalho2,4*
1IBMC-Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto, Portugal
2Center for Neuroscience and Cell Biology (CNC), University of Coimbra, Coimbra, Portugal
3Life and Health Sciences Research Institute (ICVS), School of Health Sciences, University of Minho, Braga, Portugal
4Department of Zoology, University of Coimbra, Coimbra, Portugal
David C. Rubinsztein, Editor
University of Cambridge, United Kingdom
#Contributed equally.
* E-mail:sribeiro@ibmc.up.pt (SMR);Email: alc@cnc.cj.uc.pt (ALC)
Conceived and designed the experiments: SMR PM ALC. Performed the experiments: LC ALC. Analyzed the data: SMR LC ALC. Contributed reagents/materials/analysis tools: PM. Wrote the paper: SMR LC ALC.
Received March 4, 2009; Accepted May 8, 2009.
Top
>Abstract
Introduction
Methods
Results and Discussion
References
Abstract
Spinocerebellar ataxia type-3, also known as Machado-Joseph Disease (MJD), is one of many inherited neurodegenerative disorders caused by polyglutamine-encoding CAG repeat expansions in otherwise unrelated genes. Disease protein misfolding and aggregation, often within the nucleus of affected neurons, characterize polyglutamine disorders. Several evidences have implicated the nucleus as the primary site of pathogenesis for MJD. However, the molecular determinants for the nucleocytoplasmic transport of human ataxin-3 (Atx3), the protein which is mutated in patients with MJD, are not characterized.
In order to characterize the nuclear shuttling activity of Atx3, we performed yeast nuclear import assays and found that Atx3 is actively imported into the nucleus, by means of a classical nuclear localizing sequence formed by a cluster of lysine and arginine residues. On the other hand, when active nuclear export was inhibited using leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, both endogenous Atx3 and transfected GFP-Atx3 accumulated inside the nucleus of a subpopulation of COS-7 cells, whereas both proteins are normally predominant in the cytoplasm.
Additionally, using a Rev(1.4)-GFP nuclear export assay, we performed an extensive analysis of six putative aliphatic nuclear export motifs identified in Atx3 amino acid sequence. Although none of the tested peptide sequences were found to drive nuclear export when isolated, we have successfully mapped the region of Atx3 responsible for its CRM1-independent nuclear export activity. Curiously, the N-terminal Josephin domain alone is exported into the cytoplasm, but the nuclear export activity of Atx3 is significantly enhanced in a longer construct that is truncated after the two ubiquitin interaction motifs, upstream from the polyQ tract.
Our data show that Atx3 is actively imported to and exported from the cell nucleus, and that its nuclear export activity is dependent on a motif located at its N-terminal region. Since pathological Atx3 aggregates in the nucleus of affected neurons in MJD, and there is in vivo evidence that nuclear localization of Atx3 is required for the manifestation of symptoms in MJD, defects in the nucleocytoplasmic shuttling activity of the protein may be involved in the nuclear accumulation and aggregation of expanded Atx3.
Top
Abstract
>Introduction
Methods
Results and Discussion
References
Introduction
Machado-Joseph disease (MJD), or spinocerebellar ataxia type 3, is the most common dominantly inherited ataxia worldwide and it is caused by a polyglutamine (polyQ) expansion in ataxin-3 (Atx3), a polyubiquitin-binding protein [1] with ubiquitin protease activity [2]. Full-length Atx3 contains an N-terminal Josephin domain (JD), the conserved catalytic module, two ubiquitin interacting motifs (UIMs), an expandable polyQ stretch, and a short variable tail that might contain a third UIM depending on the splice variant [3]. In normal individuals the size of the polymorphic glutamine repeat can range between 14 and 40 while in MJD patients the polyQ repeat is expanded to 53 or more glutamines [4]. Human Atx3 is ubiquitously expressed and displays a complex subcellular distribution involving both the cytoplasm and the nucleus, depending on cell type [5], [6], [7]. Even though its physiological role is still not clearly established, Atx3 was shown to be a cysteine protease with the ability to cleave polyubiquitin chains with more than four ubiquitins, independently of the polyglutamine tract [2]. This enzymatic activity of Atx3 has been correlated with its ability to mitigate polyQ-induced neurodegeneration in a Drosophila model [8], with its involvement in aggresome formation [9] and in the degradation of misfolded proteins [10]. Furthermore, it was also shown to bind to histones [11] and to chromatin [12] indicating that Atx3 displays not only cytoplasmic but also nuclear functions.
As for most other polyQ diseases, conformational changes imparted by the expanded polyQ tract lead to the formation of neuronal intranuclear inclusions (NIIs) [13] and may contribute to pathogenesis by affecting gene expression [14] or by disrupting nuclear organization and function [15]. In MJD patients specific brain regions are affected such as the cerebellum and brainstem, with prominent cell loss in the pontine and dentate nuclei [6], [16], [17]. It is becoming clear that although polyQ tracts themselves are toxic, the sequence and structure of the proteins carrying the polyQ tracts have important roles in defining the course and specificity of the disease. Those sequences determine subcellular localization, and specify interactions with other macromolecules within the cell, strongly determining the differences in the specificity of neuronal degeneration characteristic of polyQ disorders [18], [19], [20].
A contentious question has been whether polyQ-induced pathogenesis is primarily activated in the cytoplasm or in the cell nucleus. In fact predominantly nuclear inclusions have been found in SCA1, SCA2, SCA7, SCA17, DRPLA, SBMA, and Huntington's Disease (HD) patients [21], although cytoplasmic inclusions have also been identified in affected brain regions in SCA2 [22] and HD [23]. Evidence from HD transgenic mice shows that both nuclear and cytoplasmic exon-1 huntingtin might contribute to disease progression [23], [24], [25]. Nuclear environment has been shown to favor toxicity, pathology and aggregation as evidenced by nuclear targeting of polyQ peptides [26], even when inserted into ectopic protein contexts [27].
Specific nuclear localization sequences (NLS) have been identified in proteins carrying the expanded polyQ tracts, such as ataxin-1 [28], [29] and ataxin-7 [30], and nuclear-associated mechanisms are being implicated in neuropathogenesis [13], [31]. Similarly, nuclear export sequences (NES) have been found in ataxin-7 [32] and huntingtin [33] and it was shown that polyQ expansion impairs efficient nuclear export of these polyQ-containing proteins [32], [34].
Recently, it was demonstrated in vivo that adding an exogenous NLS to Atx3(148Q) increases the severity of the phenotype and induces earlier death in transgenic mouse models [35]. Accordingly, adding an exogenous NES to Atx3(148Q) drives the expanded protein out of the nucleus and prevents the manifestation of a phenotype [35]. This suggests that defects on the nucleocytoplasmic shuttling activity of the expanded protein might be correlated with pathology and neuronal specificity. Moreover, in other transgenic models of Machado-Joseph disease there is accumulation of the expanded Atx3 protein in the nucleus of affected neurons [36], [37], [38]. However, the molecular determinants for the nucleocytoplasmic transport of Atx3 are not characterized. In order to gain further insights into the function of Atx3 and into the disease-specific mechanisms of neurodegeneration in MJD, we have set as our goal the identification of the determinants of Atx3 nucleocytoplasmic transport.
Nuclear targeting was analyzed in vivo using the yeast system developed by Rhee et al. [39] and we found that Atx3 is actively imported into the nucleus, by means of a classical NLS located in its C-terminal region. Furthermore, using an in vivo nuclear export assay we show that Atx3 is actively exported from the nucleus and mapped this export activity to its N-terminal domain.
Top
Abstract
Introduction
>Methods
Results and Discussion
References
Methods
Yeast nuclear import assay
The yeast nuclear import assay was performed as described previously [39]. The cDNA encoding the MJD1.a isoform of ataxin-3 (AAB33571), containing 28 CAG repeats, was amplified by PCR using the pEGFP-C1-ataxin-3(28Q) construct (kindly provided by Dr. Henry Paulson) as template and using the primers 5′tcccccgggcatggtgagcaagggcg3′ and 5′gcgtcgacttatgtcagataaagtgtgaag3′, which introduced SmaI and SalI recognition sites at the 5′ and 3′ ends of the amplified DNA fragment, respectively. The cDNA encoding ataxin-3(28Q) was cloned into the SmaI and SalI sites of the plasmid for the yeast nuclear import assay (pNIA, kindly provided by Vitaly Citovsky [39]), and named pNIA-GFP-Atx3. The pNIA-GFP-Atx3R282T and pNIA-GFP-Atx3R282A constructs were obtained by site-directed mutagenesis (QuickChange site-directed mutagenesis kit, Stratagene).
The pNIA constructs, encoding triple fusion proteins comprising bacterial LexA, yeast Gal4p activation domain (Gal4AD), and the tested protein, were transformed using the lithium acetate method [40] into Saccharomyces cerevisiae L40 strain, which contains the reporter genes HIS3 and lacZ with upstream LexA operators. After transformation, yeasts were plated on selective medium deficient for tryptophan, to select for transformed cells. Transformed yeasts were then plated on selective medium lacking both tryptophan and histidine, and supplemented with 100 mM 3-amino-1,2,4-triazole (3AT; Sigma), an inhibitor of the His3p enzyme, and growth was evaluated. Additionally, transformed yeasts were grown in tryptophan-deficient liquid medium for quantitative determination of β-galactosidase activity [41]. For the enzymatic assay, cells were disrupted, and the β -galactosidase substrate o-nitrophenyl-β-D-galactopyranoside (ONPG) was added in excess. The reaction occurred at 30°C and was stopped by raising the pH to 11. The optical density of the reaction product was measured at 420 nm (OD420), and the β-galactosidase activity was calculated according to the following equation: βunits = 1,000×OD420/t×V×OD600, where OD420 is the optical density at 420 nm of the sample measured after the incubation of yeast cell lysate with ONPG, t is the time of incubation (in minutes) of the yeast cell lysate with ONPG, V is the volume of the sample used in the assay (in milliliters), and OD600 is the optical density at 600 nm of the yeast cell culture at the start of the assay.
Cell culture, transfection and leptomycin B treatment
HEK293 and COS-7 cells were grown and maintained in Dulbecco's modified Eagle's medium-high glucose (DMEM-HG; Sigma) supplemented with 10% (vol/vol) heat-inactivated fetal bovine serum (FBS; Biochrom KG) and with 100 U of penicillin and 100 µg of streptomycin (Sigma) per ml in a 5% CO2 humidified atmosphere at 37°C.
One day prior to transfection, COS-7 cells were seeded onto glass coverslips on a 12-well plate, at a subconfluent density. Transfection experiments were performed using Lipofectamine reagent (Invitrogen) according to the manufacturer's instructions, using 1 µg of plasmid DNA per well. The cells were incubated for 48 hours to allow gene expression.
Where indicated, the cells were incubated with 20 ng/ml leptomycin B (Sigma) in DMEM-HG supplemented with 10% FBS for 3 hours prior to fixation.
Rev(1.4)-GFP nuclear export assay
To assess the strength of the nuclear export activity of different fragments of Atx3 protein, or of full-length Atx3, the Rev(1.4)-GFP nuclear export assay, described previously by Henderson and Eleftheriou [42], was used. This assay is based on the manipulation of the Rev protein shuttling cycle, and tests for the ability of functional nuclear export sequences to promote the nuclear export activity of the Rev(1.4)-GFP fusion protein, which is composed of a NES-deficient mutant of the HIV-1 Rev protein and GFP.
Potential Atx3 NES signals were identified by consensus to the ΦX1–3ΦX2–3ΦXΦ motif (Φ indicates a large hydrophobic residue, and X indicates any amino acid), and using the prediction algorithm NetNES (http://www.cbs.dtu.dk/databases/NESbase-1.0 [43]), and fused to Rev(1.4)-GFP fusion protein (the plasmid encoding Rev(1.4)-GFP was kindly provided by Beric R. Henderson). The putative sequences that were assayed include: NES1, residues 76-SIQVISNALKVWGLELILF-94; NES2, 133-LNSLLT-138; NES3, 142-LISDTYLALFLAQLQQE-158; NES4, 174-ADQLLQMIRV-183; NES5, 209-LERVLE-214; and NES6, 222-LDEDEEDLQRALALSRQEIDME-243. Furthermore, full-length Atx3 (28Q and 84Q) or partial domains of Atx3 (the Josephin domain and the domains comprising amino acids 1–263 and 183–263) were also fused to Rev(1.4)-GFP fusion protein.
COS-7 cells were transfected with pRev(1.4)-GFP (negative control) or its derivative plasmids containing either the NES of the HIV-1 Rev protein (positive control) or each of the sequences to be tested. Forty-eight hours post-transfection, all cell samples were treated with 10 µg/ml cycloheximide (CHX) to ensure that any cytoplasmic GFP fluorescence resulted only from the nuclear export of GFP fusion proteins and not from de novo protein synthesis. Simultaneously, part of the cell samples were also treated for 3 hours with 5 µg/ml actinomycin D (ActD), which is known to specifically block the nuclear import of Rev protein by a mechanism not yet elucidated [42]. The remaining cell samples were treated with CHX, ActD and 20 ng/ml of leptomycin B for 3 hours. The subcellular localization of each GFP fusion protein was determined in at least 200 cells per experimental condition from three independent experiments.
Fluorescence microscopy
Endogenous Atx3 was detected, by immunocytochemistry, with anti-MJD antibody (1[ratio]10000), kindly provided by H. Paulson, and visualized using a secondary antibody labeled with Alexa 488 (1[ratio]1000, Invitrogen). For fluorescence analysis of GFP fusion proteins, cells were washed with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde: 4% sacarose for 15 min, and rinsed with PBS. The coverslips were then inverted and mounted on glass slides with Vectashield mounting medium (Vector Laboratories). The cell nucleus was stained with Hoescht 33342 (0,5 µg/ml, Molecular Probes). Fluorescence observations were performed using a Zeiss Axiovert 200 fluorescence microscope, coupled to a digital photographic camera (Axiocam HRM). Confocal microscopy was performed using a Zeiss LSM 510 Meta system.
Top
Abstract
Introduction
Methods
>Results and Discussion
References
Results and Discussion
Ataxin-3 has a mixed cytoplasmic and nuclear distribution
Ataxin-3 is an ubiquitous protein that is found both in the cytoplasm [44] and in the nucleus [5], [7]. However, upon expansion of the polyQ tract the protein forms insoluble inclusions predominantly located inside the nucleus of the affected cells [6]. Interestingly, the localization of the protein inside the cell is critically dependent on the cell type [5], [7]. Immunostaining of HEK293T cells with an anti-Atx3 antibody (kindly provided by H. Paulson [6]) showed that endogenous Atx3 is predominantly located in the nucleus (Fig. 1aFigure 1), while its distribution is more homogeneous in COS-7 cells (Fig. 1cFigure 1). Interestingly, when both cell lines were transiently transfected with Atx3 N-terminally tagged with GFP (GFP-Atx3 (28Q), Figs. 1e and 1gFigure 1), Atx3 was found predominantly in the cytoplasm of both cell types, in agreement with previous data [5], [6], [45].
Figure 1
Figure 1
Figure 1
Ataxin-3 can shuttle between the nucleus and the cytoplasm.
In order to determine whether Atx3 can be actively transported across the nuclear membrane we analyzed the effect of leptomycin B, a specific covalent inhibitor of the nuclear export factor CRM1/exportin [46], [47], on the subcellular distribution of both endogenous and overexpressed Atx3 in HEK293 and COS-7 cell lines. In eukaryotic cells, nuclear export of proteins is frequently mediated by this nuclear export factor, which binds to nuclear export signals (NES) on cargo molecules. If Atx3 is a nuclear shuttling protein, interfering with its putative nuclear export would be expected to modify Atx3 subcellular localization by increasing the proportion of the protein localized in the nucleus. Indeed, after cell treatment with leptomycin B both endogenous Atx3 (Figs. 1b and fFigure 1) and transfected GFP-Atx3 (28Q) (Figs. 1d, hFigure 1) accumulate in the nucleus of a subpopulation of cells, suggesting that Atx3 exits the cell nucleus by active transport at least partially dependent on the CRM1/exportin pathway. In COS-7 cells the nuclear accumulation of GFP-Atx3(28Q) could be observed in 26.5±4.5% of cells after leptomycin B treatment, whereas in untreated cells only 4.8±2.4% of cells showed nuclear accumulation of the protein. Nuclear export dependent on CRM1 receptor has also been demonstrated for other proteins containing expandable polyglutamine tracts such as ataxin-7 [32] and huntingtin [33]. In agreement with what is observed for Atx3 in the context of the full-length protein, leptomycin B treatment of cultured cells tranfected with huntingtin lead to a partial nuclear accumulation of the protein corresponding to a 10% increase in nuclear fluorescence of huntingtin [33].
Ataxin-3 contains a functional nuclear localization signal
Translocation of macromolecules larger than 40–60 kDa in and out of the nucleus is an active, energy-dependent process that is mediated by specific sequence motifs: nuclear localization signals (NLS) and nuclear export signals (NES). “Classical” examples of NLSs are the highly basic motifs originally found in the simian virus 40 (SV40) large T antigen and in nucleoplasmin, although several sequences differing from those basic ones have also been shown to function as NLS [48], [49], [50]. In “classical” nuclear import, importin-α recognizes and binds the target proteins in the cytoplasm, mediating their transport across the nuclear pore complex after formation of a ternary complex with importin-β [48], although some NLS-containing cargoes can be directly recognized by importin-β without the need of the adaptor protein. Within importin-α, the major NLS binding pocket contains a series of negatively charged residues that form salt bridges with the basic residues within the NLS sequences [51]. A putative NLS has been identified within the amino acid sequence of Atx3 [5], which is conserved among Atx3 proteins from diverse species (Fig. 2Figure 2).
Figure 2
Figure 2
Figure 2
Human ataxin-3 and its closest homologues contain conserved nuclear import sequences.
In order to test the functionality of the identified NLS sequence, we used a pNIA vector-based genetic one-hybrid system that allows identification of nuclear proteins in yeast cells [39]. This assay is based on the functional outcome of the nuclear import of the tested protein, which, if it reaches the yeast cell nucleus, allows specific induction of a reporter gene. The advantage of this approach is allowing the quantitative evaluation of the strength of the nucleocytoplasmic shuttling signals, independently of the cellular model. This system has been consistently used for mutational analysis of nuclear proteins to delineate and characterize the NLS [52] and for testing the integrity of the nuclear pore complex permeability barrier [53]. The rationale for this assay is the expression in the yeast S. cerevisiae cells of the test protein fused to a modified LexA DNA binding domain (DBD) and the Gal4 transcriptional activation domain (AD). This transcription based assay relies on the ability of a functional NLS to allow the chimera to enter the yeast nucleus and activate transcription of a LexA responsive β-galactosidase or HIS3 reporter gene. In the absence of a functional NLS, the fusion protein is not efficiently imported into the nucleus, and is unable to activate transcription. As a result, this assay provides a simple measure of NLS function based either on the quantitative determination of β-galactosidase activity or on the qualitative analysis of yeast growth in a medium lacking histidine. This system is not limited to the identification of yeast NLSs, as the nuclear import apparatus is highly conserved between yeast and higher eukaryotic cells [49], [50].
pNIA-GFP and pNIA-SV40NLS were used as controls for the nuclear import assay. pNIA-GFP encodes the fusion protein mLexA-Gal4AD-GFP and was used as negative control because it is not imported into the nucleus, resulting in minimal expression of the two reporter genes, whereas pNIA-SV40NLS encodes the fusion protein mLexA-SV40NLS-Gal4AD-GFP which, due to the presence of the SV40NLS, is actively imported into the nucleus, leading to high activity of both lacZ and HIS3 genes. The cDNA for ataxin-3 (with 28 glutamines) was cloned in the pNIA vector, and to ensure that the resulting fusion protein had a molecular weight not compatible with simple diffusion across the nuclear pore, GFP was inserted between Gal4AD and Atx3. When expressed in yeast, the pNIA-GFP-Atx3 fusion protein induced growth on histidine-deficient medium (data not shown), suggesting that Atx3 was actively imported into the nucleus. To confirm this result we performed a quantitative β-galactosidase assay, in liquid culture of yeast cells expressing the different constructs (Fig. 3Figure 3). The results obtained show that pNIA-GFPAtx3 induced levels of β-galactosidase activity significantly higher than the levels obtained for pNIA-GFP, a finding which confirms that Atx3 is actively imported into the nucleus of yeast cells.
Figure 3
Figure 3
Figure 3
Evaluation of the nuclear import capacity of ataxin-3 protein in yeast.
To determine whether the proposed NLS of Atx3 was indeed responsible for the translocation of the fusion protein into the nucleus of yeast cells, we mutated the conserved arginine residue within the putative NLS sequence into a threonine residue (pNIA-GFP-Atx3R282T). This mutation is a typical mutation performed in the analysis of conserved NLS sequences since it changes a basic residue for a neutral residue without modifying its polar character [28], and has also been shown to disrupt the function of the NLS identified in ataxin-1 and ataxin-7 [28], [30]. As shown in Figure 3Figure 3, the mutation results in the reduction the β-galactosidase activity to levels similar to the negative control (pNIA-GFP), indicating that the mutation greatly impairs Atx3 nuclear import in yeast. The mutation of the same arginine residue to an alanine residue (pNIA-GFP-Atx3R282A) was also tested, and resulted in a reduction on the nuclear accumulation of the fusion protein (Fig. 3Figure 3). These data show that interference with the putative NLS disrupts the nuclear import ability of Atx3.
The nuclear import activity of Atx3 was further confirmed in mammalian cells by comparing the subcellular localization of GFP-Atx3(28Q)R282T with GFP-Atx3(28Q) (Fig. 4Figure 4). When transfected in COS-7 cells, both constructs localized mainly in the cytoplasm of the cells. Because our data show that Atx3 can also be exported from the nucleus and that this export is at least partially mediated by the CRM1 pathway (see above), the similar localization of wild-type Atx3 and the R282T mutant might be due to the presence of competitive nuclear export signals. Therefore, in order to investigate if there is a difference between the nuclear shuttling ability of the wild-type protein and the R232T mutant in COS-7 cells, we incubated the cells with leptomycin B, thereby at least partially inhibiting nuclear export, and determined their subcellular re-localization. As shown in Fig. 1Figure 1 (panels g and h), GFP-Atx3(28Q) accumulates in the nucleus of a subpopulation of cells in the presence of leptomycin B. When GFP-Atx3(28Q)R282T is expressed in COS-7 cells this nuclear accumulation is not observed (Fig. 4Figure 4), indicating that the identified NLS sequence is also responsible for driving Atx3 into the nucleus of mammalian cells. Therefore, we conclude that Atx3 contains a basic NLS sequence that is functional and promotes its active import into the cell nucleus.
Figure 4
Figure 4
Figure 4
Evaluation of the nuclear import ability of ataxin-3 in mammalian cells.
The nuclear export of ataxin-3 is mediated by CRM1-dependent and -independent pathways
Since the nuclear export of Atx3 was partially inhibited in the presence of leptomycin B (Figs. 1Figure 1, ,4),4Figure 4), we analyzed the nuclear export activity of Atx3 using the Rev(1.4)-GFP nuclear export assay [42]. This assay is based on the expression of fusion proteins consisting of Rev(1.4), an export-defective HIV-1 Rev protein mutant, the sequence to be tested, and GFP. The nuclear export functionality of the sequence to be tested is evaluated by analyzing its capacity to promote nuclear export of the Rev(1.4)-GFP fusion protein. The Rev(1.4)-GFP fusion protein, which was used as a negative control for this assay, was localized exclusively in the nucleus of COS-7 cells, presenting a clear nucleolar accumulation (Fig. 5bFigure 5). Rev(1.4)-NES–GFP, a fusion protein that contains the Rev NES, which was used as a positive control for this assay, was localized in the nucleus and the cytoplasm of transfected cells (Fig. 5bFigure 5). The number of cells presenting exclusively cytoplasmic localization was enhanced following actinomycin D (ActD) treatment (Fig. 5bFigure 5), which blocks the nuclear import mediated by the Rev NLS [42], whereas the cytoplasmic localization of Rev(1.4)-NES-GFP was completely blocked by addition of leptomycin B (Fig. 5bFigure 5), as expected for a protein whose nuclear export is dependent on CRM1.
Figure 5
Figure 5
Figure 5
The nuclear export of ataxin-3 is mediated by the protein N-terminal domain.
Full-length Atx3 containing 28 glutamine residues [Atx3(28Q)], when fused to Rev(1.4)-GFP, was driven into the nucleus, where it formed punctuate structures resembling the insoluble nuclear inclusions (Fig. 5bFigure 5). The morphology of these structures is clearly distinct from the nucleolar accumulation of fluorescence observed for Rev(1.4)-GFP (Fig. 5bFigure 5). We also tested full-length Atx3 containing 84 glutamine residues [Atx3(84Q), Fig. 5bFigure 5], which formed punctuate structures, presumably aggregates, in the nucleus of transfected cells. These structures were not sensitive to the blockade of nuclear import of the Rev fusion protein using ActD. In fact, this result is in agreement with previous observations that Atx3 has a tendency to oligomerize independently of the expanded polyQ tract [54], [55], [56] and that the nuclear environment promotes protein misfolding and aggregation [57]. Curiously, it was observed that overexpression of ataxin-7 in cell culture models induced the nuclear localization of the protein and formation of large protein “accumulations” in ~30% of the cells, independently of the polyglutamine tract size [30].
The nuclear aggregation of full-length Atx3 when fused to Rev(1.4)-GFP, independently of the extent of the polyQ tract, presumably triggered by the strong Rev NLS, hampered the investigation of the nuclear export activity of full-length Atx3 using this system. Therefore, we prepared constructs encoding various domains of Atx3 fused to Rev(1.4)-GFP, all lacking the polyglutamine tract and the endogenous NLS (Fig. 5aFigure 5). The fusion protein consisting of the Josephin domain of Atx3 [JD-(1–182)] fused to Rev(1.4)-GFP showed a distribution between the cell nucleus and cytoplasm in 46% of the cells after cell treatment with ActD (Fig. 5bFigure 5). We also tested the cellular localization of the fusion protein consisting of the Josephin domain followed by the segment of Atx3 that contains the UIMs [Atx3(1–263)], fused to Rev(1.4)-GFP [Rev1.4-Atx3(1–263)-GFP]. This protein also displayed a nuclear and cytoplasmic localization, and the number of cells showing a mixed distribution of the protein increased to 78% after cell treatment with ActD (Fig. 5bFigure 5). The nuclear export activities of JD(1–182) and Atx3(1–263) were not inhibited by the CRM1 export inhibitor leptomycin B (+LMB).
These results suggest that the Josephin domain can mediate the nuclear export of the fusion proteins, which requires the context of the Josephin domain plus a sequence downstream this catalytic region. However, this UIM-containing segment alone [Rev(1.4)-Atx3(183–263)-GFP, Fig. 5bFigure 5] was not sufficient to promote nuclear export of the fusion protein. Finally, we asked whether the nuclear export of the Atx3(1–263) fragment was dependent on the ubiquitin binding capacity of its UIMs. It has been shown, in a cell-based assay of polyQ aggregation, that recruitment of non-expanded Atx3 into nuclear aggregates is mediated by its UIMs [58]. Therefore, we mutated the two UIMs in the Atx3(1–263) fragment in order to compromise their functionality [Atx3(1–263)(S236A,S256A)]. This protein had the same pattern of cellular distribution as the wild-type Atx3(1–263) fragment (Fig. 5bFigure 5), indicating that functionality of the UIMs is not required for the increased nuclear export activity observed for this region of Atx3.
Our results clearly demonstrate that nuclear export of Atx3 is dependent on a complex Atx3 motif, located in the N-terminal portion of the protein, which requires the context of the Josephin domain plus the ubiquitin-interacting motifs. Taken together, these data indicate either that nuclear export of Atx3 is mediated by a nuclear export receptor that recognizes a properly folded conformational motif and/or that multiple export pathways contribute to the overall nuclear export of full-length Atx3. Interestingly, a nuclear export receptor, exportin 7, has been recently described, which recognizes nuclear export signals that include conformation-dependent recognition motifs, rather than short linear sequences [59].
Since we observed nuclear accumulation of Atx3 in a population of COS-7 cells when the CRM1 transporter was inhibited with leptomycin B (Figs. 1Figure 1 and and4),4Figure 4), we looked for leucine-rich nuclear export signal (NES) sequences within Atx3 primary structure that might match the consensus NES sequence for the CRM1-dependent export [60], using the NetNES predictor (http://www.cbs.dtu.dk/databases/NESbase-1.0 [43]). We found 6 putative NES sequences, of which 4 are present within the Josephin domain (Fig. 2Figure 2, NES1-NES4), one is located between the Josephin domain and the first ubiquitin interaction domain (NES5) and the last one (NES6) corresponds to the first ubiquitin interaction motif of the protein (Fig. 2Figure 2). We have fused the putative NESs identified in Atx3 with Rev(1.4)-GFP, and tested whether the presence of these sequences can induce the translocation of Rev(1.4)-GFP from the cell nucleus. However, the isolated NES sequences failed to induce nuclear export when inserted into the Rev(1.4)-GFP vector (Table 1). The observation that in this system none of the tested sequences showed nuclear export activity can result from the fact that these sequences do not function as active leucine-rich nuclear export signals, but could also be a consequence of testing the sequences isolated from their overall protein context. For example, the isolated NES of Rev binds to CRM1 much more weakly than does the full-length Rev protein [61], implying that an NES may require flanking sequences to adopt the conformation needed for CRM1 binding. Another possibility is that each isolated sequence is not strong enough to drive detectable nuclear export of Rev1.4-GFP, which has a very strong NLS, and that several NESs work in concert to achieve efficient export of Atx3. In fact, recent studies show that most NESs bind to CRM1 with relatively low affinity, since high-affinity NES binding to CRM1 impairs the efficient release of export complexes from the nuclear pore complex [60].
Table 1
Table 1
Analysis of the nuclear export activity of putative NES sequences within ataxin-3 primary structure.
The nuclear export of GFP-Atx3(28Q) was partially inhibited by leptomycin B (Figs. 1Figure 1, ,4),4Figure 4), suggesting that a CRM1-dependent pathway is involved in the nuclear export of Atx3. On the other hand, using the Rev(1.4)-GFP fusion system, which contains a strong NLS, we detected nuclear export activity of the N-terminal portion of Atx3 (Josephin domain and UIMs) that was not sensitive to leptomycin B (Fig. 5bFigure 5). This supports the possibility that, in resemblance to what has been found for huntingtin [33], [34], CRM1-dependent and -independent nuclear export mechanisms coexist to cooperate in determining the subcellular distribution of Atx3. In the context of the full-length protein, one of these pathways may be dominant when compared to the other. Similar to that of Atx3 and huntingtin, the nuclear export of other proteins, such as α-catenin [62], receptor-interacting protein 3 (RIP3) [63] and the African Swine Fever Virus p37 protein [64], has been shown to be mediated by both CRM1-dependent and –independent pathways.
Conclusion
A correlation between the nuclear environment and protein aggregation in MJD models has been pinpointed by studies using Atx3 with an exogenously added NLS that demonstrated in situ that the nuclear environment drives aggregation of both expanded and non-expanded Atx3 [57], [65]. Recent in vivo studies have shown that adding an exogenous NES does not only suppress the formation of NIIs almost completely, but also seems to prevent the aggregation of Atx3 [35]. Furthermore, live-cell imaging studies showed that expanded polyQ tracts slow the dynamics of intact Atx3, and that the export of expanded Atx3 is less efficient than the export of normal Atx3 [66], suggesting a defect on the nucleocytoplasmic shuttling activity of the expanded protein. In fact, a recent study using a Drosophila system to screen for genetic modifiers of Atx3 neurodegeneration identified as a suppressor of Atx3-mediated toxicity, among others, the gene encoding the nuclear export protein Embargoed, the orthologue of human CRM1 [67]. In order to further understand the link between nuclear localization, aggregation and toxicity of expanded Atx3, it is essential to identify the mechanisms behind the intracellular dynamics of the normal protein. In this study, we have confirmed the functionality of the putative Atx3 NLS in yeast and mammalian cells, and detected CRM1-dependent and –independent pathways that mediate the nuclear export of Atx3. Our data show that the CRM1-independent nuclear export of Atx3 is mediated by the N-terminal region of the protein and is critically dependent on a three-dimensional motif whose integrity is compromised when the Josephin domain is physically separated from the UIMs. Future identification of the nuclear transporter(s) responsible for this pathway, will pave the way to determining how the subcellular localization of Atx3 is regulated in physiological or pathological conditions.
Acknowledgments
We are grateful to Henry Paulson for providing the pEGFP-C1-ataxin-3(28Q) plasmid, as well as the anti-ataxin-3 antibody, to Vitaly Citovsky for providing the pNIA vector and the Saccharomyces cerevisiae L40 strain, and to Beric R. Henderson for providing the Rev(1.4)-GFP and the Rev(1.4)-NES-GFP plasmids. We thank Ana Eulálio and Maria C. Pedroso de Lima for helpful advice and discussions.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported by a grant from the Portuguese Foundation for Science and Technology (POCI/SAU-MMO/60156/2004) and by Crioestaminal/Associacao Viver a Ciencia. LC was a recipient of a post-doctoral fellowship from the Portuguese Foundation for Science and Technology (SFRH/BPD/20686/2004/22). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Top
Abstract
Introduction
Methods
Results and Discussion
References
References
1.
Chai Y, Berke SS, Cohen RE, Paulson HL. Poly-ubiquitin binding by the polyglutamine disease protein ataxin-3 links its normal function to protein surveillance pathways. J Biol Chem. 2004;279:3605–3611. [PubMed]
2.
Burnett B, Li F, Pittman RN. The polyglutamine neurodegenerative protein ataxin-3 binds polyubiquitylated proteins and has ubiquitin protease activity. Hum Mol Genet. 2003;12:3195–3205. [PubMed]
3.
Masino L, Musi V, Menon RP, Fusi P, Kelly G, et al. Domain architecture of the polyglutamine protein ataxin-3: a globular domain followed by a flexible tail. FEBS Lett. 2003;549:21–25. [PubMed]
4.
Maciel P, Costa MC, Ferro A, Rousseau M, Santos CS, et al. Improvement in the molecular diagnosis of Machado-Joseph disease. Arch Neurol. 2001;58:1821–1827. [PubMed]
5.
Tait D, Riccio M, Sittler A, Scherzinger E, Santi S, et al. Ataxin-3 is transported into the nucleus and associates with the nuclear matrix. Hum Mol Genet. 1998;7:991–997. [PubMed]
6.
Paulson HL, Perez MK, Trottier Y, Trojanowski JQ, Subramony SH, et al. Intranuclear inclusions of expanded polyglutamine protein in spinocerebellar ataxia type 3. Neuron. 1997;19:333–344. [PubMed]
7.
Trottier Y, Cancel G, An-Gourfinkel I, Lutz Y, Weber C, et al. Heterogeneous intracellular localization and expression of ataxin-3. Neurobiol Dis. 1998;5:335–347. [PubMed]
8.
Warrick JM, Morabito LM, Bilen J, Gordesky-Gold B, Faust LZ, et al. Ataxin-3 suppresses polyglutamine neurodegeneration in Drosophila by a ubiquitin-associated mechanism. Mol Cell. 2005;18:37–48. [PubMed]
9.
Burnett BG, Pittman RN. The polyglutamine neurodegenerative protein ataxin 3 regulates aggresome formation. Proc Natl Acad Sci U S A. 2005;102:4330–4335. [PubMed]
10.
Wang Q, Li L, Ye Y. Regulation of retrotranslocation by p97-associated deubiquitinating enzyme ataxin-3. J Cell Biol. 2006;174:963–971. [PubMed]
11.
Li F, Macfarlan T, Pittman RN, Chakravarti D. Ataxin-3 is a histone-binding protein with two independent transcriptional corepressor activities. J Biol Chem. 2002;277:45004–45012. [PubMed]
12.
Evert BO, Araujo J, Vieira-Saecker AM, de Vos RA, Harendza S, et al. Ataxin-3 represses transcription via chromatin binding, interaction with histone deacetylase 3, and histone deacetylation. J Neurosci. 2006;26:11474–11486. [PubMed]
13.
Ross CA, Wood JD, Schilling G, Peters MF, Nucifora FC, Jr, et al. Polyglutamine pathogenesis. Philos Trans R Soc Lond B Biol Sci. 1999;354:1005–1011. [PubMed]
14.
Zoghbi HY, Orr HT. Glutamine repeats and neurodegeneration. Annu Rev Neurosci. 2000;23:217–247. [PubMed]
15.
Sun J, Xu H, Negi S, Subramony SH, Hebert MD. Differential effects of polyglutamine proteins on nuclear organization and artificial reporter splicing. J Neurosci Res. 2007;85:2306–2317. [PubMed]
16.
Sequeiros J, Coutinho P. Epidemiology and clinical aspects of Machado-Joseph disease. Adv Neurol. 1993;61:139–153. [PubMed]
17.
Schmidt T, Landwehrmeyer GB, Schmitt I, Trottier Y, Auburger G, et al. An isoform of ataxin-3 accumulates in the nucleus of neuronal cells in affected brain regions of SCA3 patients. Brain Pathol. 1998;8:669–679. [PubMed]
18.
Orr HT. Beyond the Qs in the polyglutamine diseases. Genes Dev. 2001;15:925–932. [PubMed]
19.
Paulson H. Polyglutamine neurodegeneration: minding your Ps and Qs. Nat Med. 2003;9:825–826. [PubMed]
20.
Lim J, Crespo-Barreto J, Jafar-Nejad P, Bowman AB, Richman R, et al. Opposing effects of polyglutamine expansion on native protein complexes contribute to SCA1. Nature. 2008
21.
Schols L, Bauer P, Schmidt T, Schulte T, Riess O. Autosomal dominant cerebellar ataxias: clinical features, genetics, and pathogenesis. Lancet Neurol. 2004;3:291–304. [PubMed]
22.
Huynh DP, Figueroa K, Hoang N, Pulst SM. Nuclear localization or inclusion body formation of ataxin-2 are not necessary for SCA2 pathogenesis in mouse or human. Nat Genet. 2000;26:44–50. [PubMed]
23.
DiFiglia M. Huntingtin fragments that aggregate go their separate ways. Mol Cell. 2002;10:224–225. [PubMed]
24.
Schilling G, Savonenko AV, Klevytska A, Morton JL, Tucker SM, et al. Nuclear-targeting of mutant huntingtin fragments produces Huntington's disease-like phenotypes in transgenic mice. Hum Mol Genet. 2004;13:1599–1610. [PubMed]
25.
Benn CL, Landles C, Li H, Strand AD, Woodman B, et al. Contribution of nuclear and extranuclear polyQ to neurological phenotypes in mouse models of Huntington's disease. Hum Mol Genet. 2005;14:3065–3078. [PubMed]
26.
Yang W, Dunlap JR, Andrews RB, Wetzel R. Aggregated polyglutamine peptides delivered to nuclei are toxic to mammalian cells. Hum Mol Genet. 2002;11:2905–2917. [PubMed]
27.
Jackson WS, Tallaksen-Greene SJ, Albin RL, Detloff PJ. Nucleocytoplasmic transport signals affect the age at onset of abnormalities in knock-in mice expressing polyglutamine within an ectopic protein context. Hum Mol Genet. 2003;12:1621–1629. [PubMed]
28.
Klement IA, Skinner PJ, Kaytor MD, Yi H, Hersch SM, et al. Ataxin-1 nuclear localization and aggregation: role in polyglutamine-induced disease in SCA1 transgenic mice. Cell. 1998;95:41–53. [PubMed]
29.
Irwin S, Vandelft M, Pinchev D, Howell JL, Graczyk J, et al. RNA association and nucleocytoplasmic shuttling by ataxin-1. J Cell Sci. 2005;118:233–242. [PubMed]
30.
Kaytor MD, Duvick LA, Skinner PJ, Koob MD, Ranum LP, et al. Nuclear localization of the spinocerebellar ataxia type 7 protein, ataxin-7. Hum Mol Genet. 1999;8:1657–1664. [PubMed]
31.
Orr HT. Qs in the nucleus. Neuron. 2001;31:875–876. [PubMed]
32.
Taylor J, Grote SK, Xia J, Vandelft M, Graczyk J, et al. Ataxin-7 can export from the nucleus via a conserved exportin-dependent signal. J Biol Chem. 2006;281:2730–2739. [PubMed]
33.
Xia J, Lee DH, Taylor J, Vandelft M, Truant R. Huntingtin contains a highly conserved nuclear export signal. Hum Mol Genet. 2003;12:1393–1403. [PubMed]
34.
Cornett J, Cao F, Wang CE, Ross CA, Bates GP, et al. Polyglutamine expansion of huntingtin impairs its nuclear export. Nat Genet. 2005;37:198–204. [PubMed]
35.
Bichelmeier U, Schmidt T, Hubener J, Boy J, Ruttiger L, et al. Nuclear localization of ataxin-3 is required for the manifestation of symptoms in SCA3: in vivo evidence. J Neurosci. 2007;27:7418–7428. [PubMed]
36.
Alves S, Regulier E, Nascimento-Ferreira I, Hassig R, Dufour N, et al. Striatal and nigral pathology in a lentiviral rat model of Machado-Joseph disease. Hum Mol Genet. 2008;17:2071–2083. [PubMed]
37.
Chen X, Tang TS, Tu H, Nelson O, Pook M, et al. Deranged calcium signaling and neurodegeneration in spinocerebellar ataxia type 3. J Neurosci. 2008;28:12713–12724. [PubMed]
38.
Goti D, Katzen SM, Mez J, Kurtis N, Kiluk J, et al. A mutant ataxin-3 putative-cleavage fragment in brains of Machado-Joseph disease patients and transgenic mice is cytotoxic above a critical concentration. J Neurosci. 2004;24:10266–10279. [PubMed]
39.
Rhee Y, Gurel F, Gafni Y, Dingwall C, Citovsky V. A genetic system for detection of protein nuclear import and export. Nat Biotechnol. 2000;18:433–437. [PubMed]
40.
Kaiser C, Michaelis S, Mitchell A. Methods in yeast genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1994.
41.
Stachel SE, An G, Flores C, Nester EW. A Tn3 lacZ transposon for the random generation of beta-galactosidase gene fusions: application to the analysis of gene expression in Agrobacterium. Embo J. 1985;4:891–898. [PubMed]
42.
Henderson BR, Eleftheriou A. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp Cell Res. 2000;256:213–224. [PubMed]
43.
la Cour T, Gupta R, Rapacki K, Skriver K, Poulsen FM, et al. NESbase version 1.0: a database of nuclear export signals. Nucleic Acids Res. 2003;31:393–396. [PubMed]
44.
Paulson HL, Das SS, Crino PB, Perez MK, Patel SC, et al. Machado-Joseph disease gene product is a cytoplasmic protein widely expressed in brain. Ann Neurol. 1997;41:453–462. [PubMed]
45.
Chai Y, Koppenhafer SL, Shoesmith SJ, Perez MK, Paulson HL. Evidence for proteasome involvement in polyglutamine disease: localization to nuclear inclusions in SCA3/MJD and suppression of polyglutamine aggregation in vitro. Hum Mol Genet. 1999;8:673–682. [PubMed]
46.
Kudo N, Khochbin S, Nishi K, Kitano K, Yanagida M, et al. Molecular cloning and cell cycle-dependent expression of mammalian CRM1, a protein involved in nuclear export of proteins. J Biol Chem. 1997;272:29742–29751. [PubMed]
47.
Kudo N, Wolff B, Sekimoto T, Schreiner EP, Yoneda Y, et al. Leptomycin B inhibition of signal-mediated nuclear export by direct binding to CRM1. Exp Cell Res. 1998;242:540–547. [PubMed]
48.
Lange A, Mills RE, Lange CJ, Stewart M, Devine SE, et al. Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem. 2007;282:5101–5105. [PubMed]
49.
Pemberton LF, Paschal BM. Mechanisms of receptor-mediated nuclear import and nuclear export. Traffic. 2005;6:187–198. [PubMed]
50.
Sorokin AV, Kim ER, Ovchinnikov LP. Nucleocytoplasmic transport of proteins. Biochemistry (Mosc). 2007;72:1439–1457. [PubMed]
51.
Terry LJ, Shows EB, Wente SR. Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport. Science. 2007;318:1412–1416. [PubMed]
52.
Yang B, Zhu W, Johnson LB, White FF. The virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein. Proc Natl Acad Sci U S A. 2000;97:9807–9812. [PubMed]
53.
Patel SS, Belmont BJ, Sante JM, Rexach MF. Natively unfolded nucleoporins gate protein diffusion across the nuclear pore complex. Cell. 2007;129:83–96. [PubMed]
54.
Chow MK, Paulson HL, Bottomley SP. Destabilization of a non-pathological variant of ataxin-3 results in fibrillogenesis via a partially folded intermediate: a model for misfolding in polyglutamine disease. J Mol Biol. 2004;335:333–341. [PubMed]
55.
Gales L, Cortes L, Almeida C, Melo CV, do Carmo Costa M, et al. Towards a structural understanding of the fibrillization pathway in Machado-Joseph's disease: trapping early oligomers of non-expanded ataxin-3. J Mol Biol. 2005;353:642–654. [PubMed]
56.
Masino L, Nicastro G, Menon RP, Dal Piaz F, Calder L, et al. Characterization of the structure and the amyloidogenic properties of the Josephin domain of the polyglutamine-containing protein ataxin-3. J Mol Biol. 2004;344:1021–1035. [PubMed]
57.
Perez MK, Paulson HL, Pittman RN. Ataxin-3 with an altered conformation that exposes the polyglutamine domain is associated with the nuclear matrix. Hum Mol Genet. 1999;8:2377–2385. [PubMed]
58.
Donaldson KM, Li W, Ching KA, Batalov S, Tsai CC, et al. Ubiquitin-mediated sequestration of normal cellular proteins into polyglutamine aggregates. Proc Natl Acad Sci U S A. 2003;100:8892–8897. [PubMed]
59.
Mingot JM, Bohnsack MT, Jakle U, Gorlich D. Exportin 7 defines a novel general nuclear export pathway. Embo J. 2004;23:3227–3236. [PubMed]
60.
Kutay U, Guttinger S. Leucine-rich nuclear-export signals: born to be weak. Trends Cell Biol. 2005;15:121–124. [PubMed]
61.
Paraskeva E, Izaurralde E, Bischoff FR, Huber J, Kutay U, et al. CRM1-mediated recycling of snurportin 1 to the cytoplasm. J Cell Biol. 1999;145:255–264. [PubMed]
62.
Giannini A, Mazor M, Orme M, Vivanco M, Waxman J, et al. Nuclear export of alpha-catenin: overlap between nuclear export signal sequences and the beta-catenin binding site. Exp Cell Res. 2004;295:150–160. [PubMed]
63.
Yang Y, Ma J, Chen Y, Wu M. Nucleocytoplasmic shuttling of receptor-interacting protein 3 (RIP3): identification of novel nuclear export and import signals in RIP3. J Biol Chem. 2004;279:38820–38829. [PubMed]
64.
Eulalio A, Nunes-Correia I, Carvalho AL, Faro C, Citovsky V, et al. Nuclear export of African swine fever virus p37 protein occurs through two distinct pathways and is mediated by three independent signals. J Virol. 2006;80:1393–1404. [PubMed]
65.
Perez MK, Paulson HL, Pendse SJ, Saionz SJ, Bonini NM, et al. Recruitment and the role of nuclear localization in polyglutamine-mediated aggregation. J Cell Biol. 1998;143:1457–1470. [PubMed]
66.
Chai Y, Shao J, Miller VM, Williams A, Paulson HL. Live-cell imaging reveals divergent intracellular dynamics of polyglutamine disease proteins and supports a sequestration model of pathogenesis. Proc Natl Acad Sci U S A. 2002;99:9310–9315. [PubMed]
67.
Bilen J, Bonini NM. Genome-wide screen for modifiers of ataxin-3 neurodegeneration in Drosophila. PLoS Genet. 2007;3:1950–1964. [PubMed]
68.
Gouet P, Courcelle E, Stuart DI, Metoz F. ESPript: analysis of multiple sequence alignments in PostScript. Bioinformatics. 1999;15:305–308. [PubMed]
Articles from PLoS ONE are provided here courtesy of
Public Library of Science
Write to PMC | PMC Home | PubMed
NCBI | U.S. National Library of Medicine
NIH | Department of Health and Human Services
Privacy Policy | Disclaimer | Freedom of Information Act
Tuesday, September 29, 2009
Cure PSP Webinars
Richard recently received an email to participate in a series of webinars sponsored by Cure PSP. He attended and enjoyed Dr. Susan Perlman's webinar "Ataxia, OPCA & MSA-C Look-A-Likes of PSP, CBD & MSA" on September 17, 2009. Here is the link to the slides of her presentation.
There are a series of webinars that are available in the next few months. In case anyone is interested, I am duplicating the email invitation to participate:
There are a series of webinars that are available in the next few months. In case anyone is interested, I am duplicating the email invitation to participate:
Please immediately respond to this advance invitation to ensure yourself a seat at the Movement Disorder Specialists’ FREE Webinar series sponsored by CurePSP.
Dr. Neal Hermanowicz, October 8, 2009
Dr. Robert Hutchman, October 22, 2009
Dr. Yvette Bordelon, November 5, 2009
Dr. Lawrence Golbe, November 19, 2009
Dr. Jerome Lisk, December 3, 2009
As a friend of the CurePSP you are offered a special priority to register for this Webinar.
There is only a maximum of 1,000 seats (144 seats gone in the first few days) available for each of these Webinars. We suggest that you register early, as the limited number of world-wide seats will go very, very fast. Attending the last Webinar by Dan Brooks were people from not only the United States and Canada, but also from Great Britain, France, Andorra, Kuwait, Taiwan and Australia.
Reserve your Webinar seat RIGHT NOW by CTRL left clicking on the above red button to register or copying and pasting the below link into your Web Browser:
https://www2.gotomeeting.com/register/747740042
Dr. Robert Hutchman completed his Movement Disorder Fellowship at the Mayo Clinic, Rochester, MN in 2002. His undergraduate medical training was completed at the Wayne State University School of Medicine in Detroit, MI. Since completing his training he has served as Sub-Investigator on approximately ten (10) Phase 2 thru 4 clinical drug trials. Following that incredible opportunity to develop clinical research and deep brain stimulation surgery management skills, Dr. Hutchman entered private practice in Southern California. Since arriving in California, he has founded a private practice exclusively serving a unique patient population composed of neurodegenerative disorders. As the founder and Medical Director of Neurosearch, Dr. Hutchman has successfully administered ten (10) additional clinical trials.
Reserve your Webinar seat RIGHT NOW by CTRL left clicking on the above red button to register or copying and pasting the below link into your Web Browser:
https://www2.gotomeeting.com/register/747740042
TITLE OF OCTOBER 8, 2009 PRESENTATION
“Fundamentals & Diagnosis of PSP, CBD, MSA and Related Brain Disorders”
Dr. Neal Hermanowicz
TITLE OF OCTOBER 22, 2009 PRESENTATION
“Interventions in PSP, CBD, MSA and Related Brain Disorders”
Dr. Robert Hutchman
TITLE OF NOVEMBER 5, 2009 PRESENTATION
“Latest Research in PSP, CBD, MSA and Related Brain Disorders”
Dr. Yvette Bordelon
TITLE OF NOVEMBER 19, 2009 PRESENTATION
“PSP, CBD, MSA and Related Brain Disorders Research for Dummies”
Dr. Lawrence Golbe
TITLE OF DECEMBER 3, 2009 PRESENTATION
“Two (2) hours of Medical Questions & Answers about PSP, CBD, MSA and Related Brain Disorders”
Dr. Jerome Lisk
TIME
8:00 PM Eastern Time
7:00 PM Central Time
6:00 PM Mountain Time
5:00 PM Pacific Time
Daylight Savings Time in the United States reverts to Standard Time on the first Sunday in November, so times outside of the United States might change for the November and December Webinars.
1:00 AM United Kingdom/London Time (following day)
2:00 AM South Africa/Johannesburg Time (following day)
10:00 AM Australia/Sydney Time (following day)
DURATION
10 minute introduction
40 minute presentation
10 minute refreshment/toilet break
60 minutes of Questions and Answers
Patients, caregivers, family members and medical and healthcare professionals from across the United States and Canada and from most countries of the world can listen and/or view these live Webinar. The presentation will provide guidelines to the diagnosis, treatments and research of Parkinsonism, also known as the Parkinson’s Plus Syndromes or Atypical Parkinsonian Disorders.
The upcoming Webinars are sponsored by CurePSP (Foundation for PSP | CBD and Related Brain Diseases).
You may listen and view each of the Webinars (via a slide show presentation) from the convenience of your home or office, using your computer and your attached speakers. This is FREE! No special computer software is necessary.
Or you may listen only to each of the Webinars using your land or mobile telephone. Line charges are your responsibility.
Reserve your Webinar seat RIGHT NOW by CTRL left clicking on the above red button to register or copying and pasting the below link into your Web Browser:
https://www2.gotomeeting.com/register/747740042
How to address questions to the presenters:
v During the registration process you can ask one or more questions in the “Questions & Comments” box at the end of the registration form.
v Once you have registered for these Webinars you can, up to one (1) day prior to the start of each of the Webinars, e-mail the presenter a question at Webinar.Question@gmail.com .
v If you are listening and viewing the Webinar via your computer, you can submit your questions online via the Webinar's Instant Messaging (IM) service.
v If you are listening to the Webinar via your telephone, you will not be able to ask your questions.
If you have any questions, please contact the Webinar Organizer, Outreach & Education Committee, CurePSP+ at CurePSP.Webinar.Coordinator@gmail.com .
*A Webinar is a FREE computer based web conference with up to 1,000 people from around the world viewing the conference. It is typically one-way, from the presenter to the audience. The presenter speaks to the audience, using a computer attached microphone. He/she points out information being presented via the mouse pointer on the viewers home or office computer screen. It is also possible to just listen to the presentation via a land or mobile telephone. The cost of the telephone call is paid for by the listener.
Larry Schenker
Atypical Parkinsonian Disorders Support Groups
Southern California – Mexican border north to Santa Barbara & Kern Counties
Organizer & Co-Leader
================================================================
CurePSP+ (Foundation for PSP + CBD + Related Disorders)
Outreach and Education Committee Member
Webinar Organizer
Online Support Group Organizer
================================================================
Los Angeles, California, United States of America
Tel: (310) 441-1488 - E-mail: atypical.parkinsonian.disorder@gmail.com
If you want someone to be added to this meeting notice list, send an e-mail giving the person’s name and e-mail address to subscribe.ATP@gmail.com
Subscribe to:
Posts (Atom)
